Incidental Mutation 'R0972:Nek1'
ID82874
Institutional Source Beutler Lab
Gene Symbol Nek1
Ensembl Gene ENSMUSG00000031644
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 1
Synonymskidney, anemia and testis, kat, D8Ertd790e
MMRRC Submission 039101-MU
Accession Numbers

NCBI RefSeq: NM_175089.3; MGI: 97303

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0972 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location60993195-61131346 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 61089431 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034065] [ENSMUST00000034065] [ENSMUST00000120689] [ENSMUST00000120689] [ENSMUST00000211256] [ENSMUST00000211256] [ENSMUST00000211672] [ENSMUST00000211672]
Predicted Effect probably null
Transcript: ENSMUST00000034065
SMART Domains Protein: ENSMUSP00000034065
Gene: ENSMUSG00000031644

DomainStartEndE-ValueType
S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 556 592 N/A INTRINSIC
coiled coil region 647 685 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000034065
SMART Domains Protein: ENSMUSP00000034065
Gene: ENSMUSG00000031644

DomainStartEndE-ValueType
S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 556 592 N/A INTRINSIC
coiled coil region 647 685 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120689
SMART Domains Protein: ENSMUSP00000113932
Gene: ENSMUSG00000031644

DomainStartEndE-ValueType
S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 487 510 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
coiled coil region 584 620 N/A INTRINSIC
coiled coil region 675 713 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
low complexity region 1158 1169 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120689
SMART Domains Protein: ENSMUSP00000113932
Gene: ENSMUSG00000031644

DomainStartEndE-ValueType
S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 487 510 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
coiled coil region 584 620 N/A INTRINSIC
coiled coil region 675 713 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
low complexity region 1158 1169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142601
SMART Domains Protein: ENSMUSP00000121479
Gene: ENSMUSG00000031644

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
coiled coil region 162 198 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155664
Predicted Effect probably null
Transcript: ENSMUST00000211256
Predicted Effect probably null
Transcript: ENSMUST00000211256
Predicted Effect probably null
Transcript: ENSMUST00000211672
Predicted Effect probably null
Transcript: ENSMUST00000211672
Meta Mutation Damage Score 0.6472 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (72/74)
MGI Phenotype Strain: 1858030; 1858122
Lethality: D14-D365
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase involved in cell cycle regulation. The encoded protein is found in a centrosomal complex with FEZ1, a neuronal protein that plays a role in axonal development. Defects in this gene are a cause of polycystic kidney disease (PKD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Spontaneous mutations of this gene result in pleiotropic effects that include facial dysmorphism, dwarfism, male sterility, anemia, cystic choroid plexus, a late-onset slowly progressive polycystic kidney disease, and premature death. Postnatal survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(1) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G A 8: 40,755,131 R478Q probably damaging Het
Adgrf5 A T 17: 43,450,983 S1190C probably damaging Het
Akr1a1 T C 4: 116,640,007 probably null Het
Bco2 A T 9: 50,536,315 D369E probably benign Het
Blm A T 7: 80,513,370 S78T probably benign Het
Brsk2 C G 7: 141,993,704 probably benign Het
Cct8 A G 16: 87,486,620 V269A possibly damaging Het
Cdh12 A T 15: 21,237,764 Q28H probably benign Het
Cep290 A G 10: 100,518,762 T896A probably benign Het
Chrm2 T A 6: 36,524,466 N419K possibly damaging Het
Clasp2 A T 9: 113,847,705 H168L possibly damaging Het
Cog3 A T 14: 75,717,170 M643K probably benign Het
Col6a5 A G 9: 105,940,285 S276P unknown Het
Colgalt2 T C 1: 152,471,744 V143A probably damaging Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Ddx56 A T 11: 6,267,718 M1K probably null Het
Dnah3 C T 7: 120,035,340 probably null Het
Dnah6 T C 6: 73,159,193 T988A possibly damaging Het
Esp15 T A 17: 39,642,666 F15I possibly damaging Het
Fbxo18 C T 2: 11,764,088 probably benign Het
Gm8773 T A 5: 5,575,512 D69E probably benign Het
Gucy1b2 A T 14: 62,408,678 I572N possibly damaging Het
Gucy1b2 T C 14: 62,414,369 I393V possibly damaging Het
Herc1 C A 9: 66,372,145 R112S probably damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Itga7 G A 10: 128,942,877 R291H probably damaging Het
Jag1 A G 2: 137,083,451 L1077S possibly damaging Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Klrc2 T C 6: 129,658,763 Y134C probably damaging Het
Map2k2 C A 10: 81,119,648 D67E probably benign Het
Mest G A 6: 30,740,684 W14* probably null Het
Mier2 A G 10: 79,544,621 probably benign Het
Mog A G 17: 37,017,532 V169A probably benign Het
Mov10l1 T C 15: 89,021,279 V879A probably damaging Het
Mrgpra9 A G 7: 47,235,455 S155P probably damaging Het
Mtmr10 A G 7: 64,326,709 D418G probably damaging Het
Mtpn T C 6: 35,521,976 D58G probably null Het
Myh8 A G 11: 67,297,759 R1056G probably damaging Het
Olfr1043 A C 2: 86,162,304 L215R possibly damaging Het
Olfr1282 T C 2: 111,335,418 Y220C probably benign Het
Olfr883 T A 9: 38,026,560 F251L possibly damaging Het
Pcnx G A 12: 81,913,412 D181N probably damaging Het
Pdzrn4 A G 15: 92,757,711 D495G probably benign Het
Plppr3 A G 10: 79,865,086 S641P probably damaging Het
Pramef6 T A 4: 143,896,963 T214S probably benign Het
Prelp A T 1: 133,914,676 Y244N probably damaging Het
Prg2 C A 2: 84,982,049 N34K probably benign Het
Ptp4a1 A G 1: 30,944,999 V46A possibly damaging Het
Rpl6 A G 5: 121,208,502 D222G possibly damaging Het
Rtp1 A T 16: 23,431,308 D141V probably damaging Het
Sacs T A 14: 61,211,963 Y3819* probably null Het
Serinc5 A G 13: 92,688,620 T186A probably benign Het
Slc15a2 A G 16: 36,757,139 S422P probably benign Het
Slc2a8 A T 2: 32,975,367 V366D probably benign Het
Smarca1 T C X: 47,849,987 R715G possibly damaging Het
Spdef C T 17: 27,715,023 A275T probably damaging Het
Tcf21 T C 10: 22,819,722 K61R probably benign Het
Tep1 A G 14: 50,824,296 probably benign Het
Thada G A 17: 84,429,062 probably benign Het
Thap11 T A 8: 105,856,178 I273N probably damaging Het
Tmem129 T A 5: 33,654,768 E262V possibly damaging Het
Tnxb A G 17: 34,685,143 Y1086C probably damaging Het
Togaram2 A G 17: 71,707,314 Y619C probably damaging Het
Top1 C T 2: 160,721,025 A717V probably damaging Het
Trpm7 G A 2: 126,805,049 P1507S probably benign Het
Ubr2 A T 17: 46,934,261 probably null Het
Usp30 T C 5: 114,111,864 probably benign Het
Vmn1r3 T A 4: 3,185,125 I61F probably damaging Het
Zbtb22 C T 17: 33,917,352 T157I possibly damaging Het
Zfp677 A T 17: 21,398,310 H543L probably damaging Het
Zranb3 G T 1: 127,956,646 P1001Q probably damaging Het
Other mutations in Nek1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Nek1 APN 8 61043284 missense probably benign 0.00
IGL01075:Nek1 APN 8 61124132 missense possibly damaging 0.64
IGL01122:Nek1 APN 8 61120966 missense possibly damaging 0.80
IGL01151:Nek1 APN 8 61020077 missense probably damaging 1.00
IGL01286:Nek1 APN 8 61124216 missense possibly damaging 0.64
IGL01377:Nek1 APN 8 61089456 missense probably benign
IGL01485:Nek1 APN 8 61049826 missense probably benign 0.02
IGL01688:Nek1 APN 8 61105597 nonsense probably null
IGL01806:Nek1 APN 8 61124212 missense possibly damaging 0.82
IGL02006:Nek1 APN 8 61104192 missense probably benign 0.20
IGL02304:Nek1 APN 8 61012167 missense probably damaging 1.00
IGL02659:Nek1 APN 8 61089480 missense probably benign 0.16
IGL02662:Nek1 APN 8 61104184 missense probably benign 0.00
IGL02801:Nek1 APN 8 61121061 critical splice donor site probably null
IGL02806:Nek1 APN 8 61044086 missense probably benign 0.15
IGL03037:Nek1 APN 8 61034052 missense probably benign 0.16
IGL03252:Nek1 APN 8 61072330 nonsense probably null
P0014:Nek1 UTSW 8 61071747 splice site probably benign
R0019:Nek1 UTSW 8 61089734 missense probably benign 0.01
R0403:Nek1 UTSW 8 61106855 missense probably damaging 0.99
R0464:Nek1 UTSW 8 61072273 splice site probably benign
R0726:Nek1 UTSW 8 61089592 missense probably damaging 1.00
R0761:Nek1 UTSW 8 61089455 missense probably benign
R0827:Nek1 UTSW 8 61105648 splice site probably benign
R1268:Nek1 UTSW 8 61022264 missense probably damaging 1.00
R1343:Nek1 UTSW 8 61028675 missense probably damaging 1.00
R1415:Nek1 UTSW 8 61089686 missense probably benign 0.00
R1466:Nek1 UTSW 8 61125136 splice site probably benign
R1480:Nek1 UTSW 8 61124326 splice site probably null
R1526:Nek1 UTSW 8 61049941 missense probably benign 0.26
R1552:Nek1 UTSW 8 61006737 missense probably damaging 0.99
R1606:Nek1 UTSW 8 61124276 missense possibly damaging 0.82
R1650:Nek1 UTSW 8 61036076 missense probably benign 0.00
R1757:Nek1 UTSW 8 61089813 splice site probably null
R1808:Nek1 UTSW 8 61016230 missense probably damaging 1.00
R1966:Nek1 UTSW 8 61016296 missense probably damaging 1.00
R2067:Nek1 UTSW 8 61007162 missense probably damaging 1.00
R2111:Nek1 UTSW 8 61124326 splice site probably null
R2113:Nek1 UTSW 8 61016293 missense probably damaging 1.00
R2143:Nek1 UTSW 8 61028696 missense probably damaging 1.00
R2255:Nek1 UTSW 8 61089773 missense probably damaging 1.00
R2422:Nek1 UTSW 8 61019901 missense probably damaging 1.00
R3848:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R3849:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R3850:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R4418:Nek1 UTSW 8 61106864 missense probably damaging 1.00
R4526:Nek1 UTSW 8 61106944 missense probably damaging 0.99
R4533:Nek1 UTSW 8 61007213 missense possibly damaging 0.95
R4544:Nek1 UTSW 8 61016304 nonsense probably null
R4677:Nek1 UTSW 8 61028806 missense probably damaging 0.99
R4739:Nek1 UTSW 8 61098511 missense probably benign 0.32
R5068:Nek1 UTSW 8 61016296 missense probably damaging 1.00
R5421:Nek1 UTSW 8 61006677 missense possibly damaging 0.81
R5516:Nek1 UTSW 8 61089489 missense probably benign 0.03
R5855:Nek1 UTSW 8 61016272 missense probably damaging 1.00
R6125:Nek1 UTSW 8 61028701 missense probably damaging 1.00
R6267:Nek1 UTSW 8 61072309 nonsense probably null
R6292:Nek1 UTSW 8 61054736 intron probably null
R6296:Nek1 UTSW 8 61072309 nonsense probably null
R6458:Nek1 UTSW 8 61100012 missense probably benign 0.00
R6568:Nek1 UTSW 8 61106821 missense probably benign 0.00
R6629:Nek1 UTSW 8 61054333 intron probably null
R6867:Nek1 UTSW 8 61072330 missense possibly damaging 0.81
R7122:Nek1 UTSW 8 61106795 missense probably benign 0.00
R7193:Nek1 UTSW 8 61073578 missense probably damaging 0.99
R7272:Nek1 UTSW 8 61125086 missense probably benign 0.34
R7356:Nek1 UTSW 8 61120960 missense probably benign 0.02
R7368:Nek1 UTSW 8 61089707 missense probably benign 0.24
X0028:Nek1 UTSW 8 61043258 missense probably benign 0.19
X0066:Nek1 UTSW 8 61125128 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTGGCACATAATTGAGAACTGACCC -3'
(R):5'- AGAACCTGAGTGATGCTGCTTTTCC -3'

Sequencing Primer
(F):5'- TGAGAAAAGTTCACAGAGGTCA -3'
(R):5'- GCTTTAAGATTTTCATTTAGCCTACG -3'
Posted On2013-11-08