Incidental Mutation 'R0972:Sacs'
ID82894
Institutional Source Beutler Lab
Gene Symbol Sacs
Ensembl Gene ENSMUSG00000048279
Gene Namesacsin
SynonymsE130115J16Rik
MMRRC Submission 039101-MU
Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R0972 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location61138457-61240695 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 61211963 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 3819 (Y3819*)
Ref Sequence ENSEMBL: ENSMUSP00000113377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119943]
Predicted Effect probably benign
Transcript: ENSMUST00000089394
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119943
AA Change: Y3819*
SMART Domains Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: Y3819*

DomainStartEndE-ValueType
internal_repeat_1 61 514 1.35e-52 PROSPERO
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1526 1537 N/A INTRINSIC
low complexity region 2454 2463 N/A INTRINSIC
internal_repeat_1 2475 2934 1.35e-52 PROSPERO
low complexity region 3751 3760 N/A INTRINSIC
low complexity region 3997 4012 N/A INTRINSIC
low complexity region 4285 4300 N/A INTRINSIC
Blast:DnaJ 4304 4363 1e-31 BLAST
PDB:1IUR|A 4309 4376 5e-39 PDB
SCOP:d1gh6a_ 4317 4407 2e-3 SMART
HEPN 4454 4570 9.49e-24 SMART
Meta Mutation Damage Score 0.57 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (72/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G A 8: 40,755,131 R478Q probably damaging Het
Adgrf5 A T 17: 43,450,983 S1190C probably damaging Het
Akr1a1 T C 4: 116,640,007 probably null Het
Bco2 A T 9: 50,536,315 D369E probably benign Het
Blm A T 7: 80,513,370 S78T probably benign Het
Brsk2 C G 7: 141,993,704 probably benign Het
Cct8 A G 16: 87,486,620 V269A possibly damaging Het
Cdh12 A T 15: 21,237,764 Q28H probably benign Het
Cep290 A G 10: 100,518,762 T896A probably benign Het
Chrm2 T A 6: 36,524,466 N419K possibly damaging Het
Clasp2 A T 9: 113,847,705 H168L possibly damaging Het
Cog3 A T 14: 75,717,170 M643K probably benign Het
Col6a5 A G 9: 105,940,285 S276P unknown Het
Colgalt2 T C 1: 152,471,744 V143A probably damaging Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Ddx56 A T 11: 6,267,718 M1K probably null Het
Dnah3 C T 7: 120,035,340 probably null Het
Dnah6 T C 6: 73,159,193 T988A possibly damaging Het
Esp15 T A 17: 39,642,666 F15I possibly damaging Het
Fbxo18 C T 2: 11,764,088 probably benign Het
Gm8773 T A 5: 5,575,512 D69E probably benign Het
Gucy1b2 A T 14: 62,408,678 I572N possibly damaging Het
Gucy1b2 T C 14: 62,414,369 I393V possibly damaging Het
Herc1 C A 9: 66,372,145 R112S probably damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Itga7 G A 10: 128,942,877 R291H probably damaging Het
Jag1 A G 2: 137,083,451 L1077S possibly damaging Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Klrc2 T C 6: 129,658,763 Y134C probably damaging Het
Map2k2 C A 10: 81,119,648 D67E probably benign Het
Mest G A 6: 30,740,684 W14* probably null Het
Mier2 A G 10: 79,544,621 probably benign Het
Mog A G 17: 37,017,532 V169A probably benign Het
Mov10l1 T C 15: 89,021,279 V879A probably damaging Het
Mrgpra9 A G 7: 47,235,455 S155P probably damaging Het
Mtmr10 A G 7: 64,326,709 D418G probably damaging Het
Mtpn T C 6: 35,521,976 D58G probably null Het
Myh8 A G 11: 67,297,759 R1056G probably damaging Het
Nek1 T A 8: 61,089,431 probably null Het
Olfr1043 A C 2: 86,162,304 L215R possibly damaging Het
Olfr1282 T C 2: 111,335,418 Y220C probably benign Het
Olfr883 T A 9: 38,026,560 F251L possibly damaging Het
Pcnx G A 12: 81,913,412 D181N probably damaging Het
Pdzrn4 A G 15: 92,757,711 D495G probably benign Het
Plppr3 A G 10: 79,865,086 S641P probably damaging Het
Pramef6 T A 4: 143,896,963 T214S probably benign Het
Prelp A T 1: 133,914,676 Y244N probably damaging Het
Prg2 C A 2: 84,982,049 N34K probably benign Het
Ptp4a1 A G 1: 30,944,999 V46A possibly damaging Het
Rpl6 A G 5: 121,208,502 D222G possibly damaging Het
Rtp1 A T 16: 23,431,308 D141V probably damaging Het
Serinc5 A G 13: 92,688,620 T186A probably benign Het
Slc15a2 A G 16: 36,757,139 S422P probably benign Het
Slc2a8 A T 2: 32,975,367 V366D probably benign Het
Smarca1 T C X: 47,849,987 R715G possibly damaging Het
Spdef C T 17: 27,715,023 A275T probably damaging Het
Tcf21 T C 10: 22,819,722 K61R probably benign Het
Tep1 A G 14: 50,824,296 probably benign Het
Thada G A 17: 84,429,062 probably benign Het
Thap11 T A 8: 105,856,178 I273N probably damaging Het
Tmem129 T A 5: 33,654,768 E262V possibly damaging Het
Tnxb A G 17: 34,685,143 Y1086C probably damaging Het
Togaram2 A G 17: 71,707,314 Y619C probably damaging Het
Top1 C T 2: 160,721,025 A717V probably damaging Het
Trpm7 G A 2: 126,805,049 P1507S probably benign Het
Ubr2 A T 17: 46,934,261 probably null Het
Usp30 T C 5: 114,111,864 probably benign Het
Vmn1r3 T A 4: 3,185,125 I61F probably damaging Het
Zbtb22 C T 17: 33,917,352 T157I possibly damaging Het
Zfp677 A T 17: 21,398,310 H543L probably damaging Het
Zranb3 G T 1: 127,956,646 P1001Q probably damaging Het
Other mutations in Sacs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Sacs APN 14 61191635 missense possibly damaging 0.64
IGL01839:Sacs APN 14 61183945 intron probably benign
IGL02024:Sacs APN 14 61189678 missense probably damaging 0.96
IGL02247:Sacs APN 14 61192535 missense probably damaging 1.00
F6893:Sacs UTSW 14 61212976 missense probably benign
IGL03052:Sacs UTSW 14 61207858 missense probably damaging 0.99
R0090:Sacs UTSW 14 61205440 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0390:Sacs UTSW 14 61205640 missense possibly damaging 0.92
R0479:Sacs UTSW 14 61191479 missense probably damaging 0.99
R0556:Sacs UTSW 14 61183958 missense probably damaging 0.99
R0673:Sacs UTSW 14 61210215 missense possibly damaging 0.89
R0748:Sacs UTSW 14 61209265 missense probably damaging 0.99
R0931:Sacs UTSW 14 61203495 missense probably benign
R1281:Sacs UTSW 14 61191801 missense probably benign 0.02
R1340:Sacs UTSW 14 61204509 missense probably damaging 0.98
R1351:Sacs UTSW 14 61202761 missense probably benign 0.00
R1499:Sacs UTSW 14 61213704 missense possibly damaging 0.70
R1538:Sacs UTSW 14 61210059 missense probably damaging 0.98
R1581:Sacs UTSW 14 61213679 missense probably damaging 0.96
R1599:Sacs UTSW 14 61203638 missense probably benign
R1631:Sacs UTSW 14 61210732 nonsense probably null
R1635:Sacs UTSW 14 61203828 missense probably damaging 0.98
R1655:Sacs UTSW 14 61191782 missense probably benign
R1660:Sacs UTSW 14 61209009 missense probably damaging 0.99
R1707:Sacs UTSW 14 61209762 missense probably benign 0.01
R1733:Sacs UTSW 14 61205454 missense probably damaging 1.00
R1772:Sacs UTSW 14 61210897 missense probably damaging 1.00
R1976:Sacs UTSW 14 61202895 missense probably benign
R2055:Sacs UTSW 14 61214049 missense probably damaging 0.97
R2083:Sacs UTSW 14 61206506 missense possibly damaging 0.69
R2091:Sacs UTSW 14 61191919 missense possibly damaging 0.95
R2105:Sacs UTSW 14 61173441 missense possibly damaging 0.90
R2109:Sacs UTSW 14 61173453 splice site probably null
R2117:Sacs UTSW 14 61213771 missense probably benign 0.01
R2122:Sacs UTSW 14 61212316 missense probably damaging 1.00
R2148:Sacs UTSW 14 61173378 missense probably damaging 0.97
R2151:Sacs UTSW 14 61209640 missense probably damaging 1.00
R2231:Sacs UTSW 14 61205929 unclassified probably null
R2248:Sacs UTSW 14 61212802 missense probably damaging 1.00
R2271:Sacs UTSW 14 61204660 missense probably benign 0.06
R2314:Sacs UTSW 14 61207759 missense probably benign 0.17
R2436:Sacs UTSW 14 61202905 missense possibly damaging 0.94
R2445:Sacs UTSW 14 61205206 missense probably damaging 1.00
R2512:Sacs UTSW 14 61203080 missense probably benign 0.00
R3434:Sacs UTSW 14 61212303 missense probably damaging 1.00
R3785:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3786:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3796:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3798:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3872:Sacs UTSW 14 61148068 missense probably benign 0.30
R3873:Sacs UTSW 14 61192286 missense possibly damaging 0.64
R3892:Sacs UTSW 14 61204387 missense probably damaging 0.98
R4184:Sacs UTSW 14 61213944 missense probably damaging 0.97
R4204:Sacs UTSW 14 61173443 missense possibly damaging 0.93
R4249:Sacs UTSW 14 61203457 missense probably benign 0.02
R4256:Sacs UTSW 14 61206337 missense probably damaging 1.00
R4370:Sacs UTSW 14 61212309 missense probably damaging 1.00
R4445:Sacs UTSW 14 61204686 missense probably benign 0.30
R4503:Sacs UTSW 14 61207603 missense probably damaging 1.00
R4548:Sacs UTSW 14 61191938 missense probably damaging 1.00
R4582:Sacs UTSW 14 61191698 missense probably damaging 1.00
R4613:Sacs UTSW 14 61211797 intron probably null
R4639:Sacs UTSW 14 61207268 missense probably benign 0.12
R4697:Sacs UTSW 14 61212747 missense probably benign 0.19
R4706:Sacs UTSW 14 61204273 missense probably damaging 1.00
R4717:Sacs UTSW 14 61212855 missense probably damaging 1.00
R4777:Sacs UTSW 14 61211809 missense probably damaging 1.00
R4888:Sacs UTSW 14 61212198 missense probably damaging 1.00
R4913:Sacs UTSW 14 61213797 missense probably benign 0.17
R4973:Sacs UTSW 14 61213122 missense probably damaging 1.00
R4986:Sacs UTSW 14 61213043 nonsense probably null
R5090:Sacs UTSW 14 61205253 missense probably damaging 1.00
R5243:Sacs UTSW 14 61205957 nonsense probably null
R5292:Sacs UTSW 14 61211983 missense probably damaging 1.00
R5308:Sacs UTSW 14 61192400 missense probably benign 0.21
R5337:Sacs UTSW 14 61193514 intron probably benign
R5502:Sacs UTSW 14 61206100 missense probably damaging 1.00
R5586:Sacs UTSW 14 61206441 nonsense probably null
R5692:Sacs UTSW 14 61207839 missense probably benign 0.00
R5725:Sacs UTSW 14 61211110 missense probably damaging 1.00
R5854:Sacs UTSW 14 61211547 missense probably damaging 1.00
R5959:Sacs UTSW 14 61212400 missense probably damaging 0.99
R5960:Sacs UTSW 14 61208695 missense probably benign 0.30
R5968:Sacs UTSW 14 61189629 missense probably damaging 0.99
R5983:Sacs UTSW 14 61205199 missense probably damaging 1.00
R5992:Sacs UTSW 14 61205543 missense probably damaging 1.00
R6076:Sacs UTSW 14 61204536 nonsense probably null
R6175:Sacs UTSW 14 61212826 missense possibly damaging 0.82
R6347:Sacs UTSW 14 61211160 missense probably damaging 1.00
R6357:Sacs UTSW 14 61208824 missense possibly damaging 0.47
R6415:Sacs UTSW 14 61205359 missense probably damaging 1.00
R6469:Sacs UTSW 14 61191248 missense probably damaging 1.00
R6503:Sacs UTSW 14 61211361 missense probably benign 0.00
R6523:Sacs UTSW 14 61202961 missense probably damaging 0.99
R6615:Sacs UTSW 14 61208934 missense probably benign 0.15
R6729:Sacs UTSW 14 61210518 missense probably damaging 1.00
R6731:Sacs UTSW 14 61180700 intron probably null
R6797:Sacs UTSW 14 61213073 missense probably damaging 1.00
R6852:Sacs UTSW 14 61179288 missense possibly damaging 0.87
R6922:Sacs UTSW 14 61211425 missense probably damaging 1.00
X0067:Sacs UTSW 14 61208019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAAGAAGGCAGTGACCTCGCTC -3'
(R):5'- AGATGCTTGACTTCACCAACTTCCC -3'

Sequencing Primer
(F):5'- TGGACCCCCCTCTTGATAAG -3'
(R):5'- TGTAGACTCTTGAATAGGCCAG -3'
Posted On2013-11-08