Incidental Mutation 'R0924:Nckap1'
ID83058
Institutional Source Beutler Lab
Gene Symbol Nckap1
Ensembl Gene ENSMUSG00000027002
Gene NameNCK-associated protein 1
Synonymsmh19, Hem-2, Nap1, Hem2, H19
MMRRC Submission 039071-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0924 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location80500512-80581380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80554249 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 114 (C114S)
Ref Sequence ENSEMBL: ENSMUSP00000107390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028386] [ENSMUST00000111760]
Predicted Effect probably benign
Transcript: ENSMUST00000028386
AA Change: C108S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000028386
Gene: ENSMUSG00000027002
AA Change: C108S

DomainStartEndE-ValueType
Pfam:Nckap1 8 1124 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082735
Predicted Effect probably benign
Transcript: ENSMUST00000111760
AA Change: C114S

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107390
Gene: ENSMUSG00000027002
AA Change: C114S

DomainStartEndE-ValueType
Pfam:Nckap1 9 1128 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134587
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 97% (69/71)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene exhibit growth arrest at midgestation, an open neural tube, cardia bifida, defective foregut development, defects in endoderm and mesoderm migration and sometimes duplication of the anteroposterior body axis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,251,070 probably benign Het
9530053A07Rik A T 7: 28,140,130 Y456F probably damaging Het
Adamts18 A T 8: 113,705,396 probably null Het
Ahcyl2 A C 6: 29,870,628 probably null Het
Ajap1 T A 4: 153,386,472 I293F probably damaging Het
Akap10 T C 11: 61,904,863 probably benign Het
Aldh3b2 T C 19: 3,979,350 V241A probably benign Het
Anxa6 A T 11: 54,994,388 probably null Het
Atpaf1 T A 4: 115,795,438 V12D probably damaging Het
Aurkb C A 11: 69,045,996 Y12* probably null Het
Bicdl1 A G 5: 115,661,528 probably benign Het
Bnc1 A T 7: 81,978,408 probably benign Het
Bpi A G 2: 158,261,426 I114V possibly damaging Het
Cacna1c A T 6: 118,675,896 I772N probably damaging Het
Cacna2d1 A G 5: 16,365,862 N1045D possibly damaging Het
Ccrl2 A G 9: 111,055,968 V154A probably benign Het
Celsr3 C A 9: 108,846,025 Q2831K possibly damaging Het
Cul3 A T 1: 80,290,118 M102K probably damaging Het
Cwf19l2 T C 9: 3,441,047 probably benign Het
Dlg5 G A 14: 24,135,577 P1920L probably damaging Het
Dnah2 T C 11: 69,421,308 H4393R probably damaging Het
Eif2b3 T A 4: 117,081,578 V408D possibly damaging Het
Eml3 T C 19: 8,933,311 probably null Het
Enpp2 T C 15: 54,906,959 probably benign Het
Gm14178 T A 11: 99,747,500 T18S Het
H2-Bl A T 17: 36,083,932 V33E probably damaging Het
H2-M11 A G 17: 36,549,214 M324V probably benign Het
Hdac10 T C 15: 89,125,862 T298A probably benign Het
Hepacam A C 9: 37,383,928 probably benign Het
Hist1h2bk G A 13: 22,036,040 D52N probably damaging Het
Hmx3 A T 7: 131,543,084 H41L probably benign Het
Ifi27l2a A G 12: 103,442,380 V68A probably damaging Het
Itga11 A G 9: 62,776,674 E1079G probably benign Het
Krt6a T C 15: 101,690,800 probably benign Het
L1td1 A G 4: 98,737,625 N686D probably damaging Het
Lrrtm2 G A 18: 35,213,755 R165C probably damaging Het
Macf1 G T 4: 123,385,478 A3910E probably damaging Het
Muc5ac A T 7: 141,807,515 Y1521F possibly damaging Het
Myo7a A T 7: 98,098,256 I129N probably damaging Het
Ncam1 A T 9: 49,562,176 probably benign Het
Nf1 T G 11: 79,453,866 W1260G probably damaging Het
Olfr1415 A G 1: 92,491,405 S117P possibly damaging Het
Olfr411 T C 11: 74,346,798 Y262C probably damaging Het
Olfr813 A T 10: 129,856,646 I43F probably damaging Het
Oxtr A T 6: 112,489,637 probably null Het
Pabpc4 C T 4: 123,294,665 R356C possibly damaging Het
Pcbp2 T A 15: 102,489,762 D182E probably damaging Het
Pgm1 A T 5: 64,112,147 I526F possibly damaging Het
Rab43 A T 6: 87,792,770 Y151* probably null Het
Rbm19 A G 5: 120,126,204 E343G probably benign Het
Rel A T 11: 23,742,439 D531E probably benign Het
Rfx4 T A 10: 84,868,427 V262E probably damaging Het
Rnf31 T C 14: 55,593,002 probably benign Het
Robo3 T A 9: 37,429,482 probably benign Het
Ryr3 A G 2: 112,841,833 L1431P probably damaging Het
Sema3d A C 5: 12,463,216 D51A possibly damaging Het
Sema6a A G 18: 47,248,492 L996P probably damaging Het
Sh2d4a T A 8: 68,335,123 F294I probably damaging Het
Sorl1 T A 9: 42,008,174 probably benign Het
Sox1ot G T 8: 12,430,455 noncoding transcript Het
Spsb3 A T 17: 24,891,384 N395I probably damaging Het
Sptan1 A G 2: 30,016,028 N1662S probably damaging Het
Srd5a2 G T 17: 74,024,521 N160K probably damaging Het
Tmem132d G A 5: 127,984,439 probably benign Het
Tmem173 A G 18: 35,735,101 probably null Het
Unc80 A T 1: 66,510,641 Q686L possibly damaging Het
Vmn2r93 A G 17: 18,304,181 T146A probably benign Het
Wdr19 A G 5: 65,256,439 probably benign Het
Zfp646 C T 7: 127,883,810 Q1500* probably null Het
Zfp683 T C 4: 134,055,827 Y201H probably benign Het
Other mutations in Nckap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Nckap1 APN 2 80506202 missense possibly damaging 0.87
IGL00896:Nckap1 APN 2 80580953 missense possibly damaging 0.59
IGL01343:Nckap1 APN 2 80519842 missense possibly damaging 0.81
IGL01593:Nckap1 APN 2 80520570 missense probably benign 0.06
IGL01677:Nckap1 APN 2 80530297 missense probably benign 0.04
IGL01873:Nckap1 APN 2 80553385 missense possibly damaging 0.95
IGL01874:Nckap1 APN 2 80525636 missense probably damaging 1.00
IGL01947:Nckap1 APN 2 80508753 missense probably damaging 1.00
IGL02268:Nckap1 APN 2 80528618 missense probably benign 0.16
IGL02348:Nckap1 APN 2 80517982 missense probably damaging 1.00
IGL03349:Nckap1 APN 2 80525560 missense probably benign 0.07
PIT4151001:Nckap1 UTSW 2 80520370 critical splice donor site probably null
R0326:Nckap1 UTSW 2 80553370 missense probably benign 0.41
R0345:Nckap1 UTSW 2 80544977 splice site probably benign
R0520:Nckap1 UTSW 2 80541530 splice site probably benign
R0603:Nckap1 UTSW 2 80512729 missense probably benign 0.19
R0930:Nckap1 UTSW 2 80554249 missense probably benign 0.34
R0964:Nckap1 UTSW 2 80547899 critical splice donor site probably null
R1122:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1123:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1124:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1125:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1127:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1182:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1234:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1236:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1384:Nckap1 UTSW 2 80533670 missense possibly damaging 0.90
R1402:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1402:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1511:Nckap1 UTSW 2 80553415 missense probably damaging 0.99
R1677:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1686:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1687:Nckap1 UTSW 2 80520585 missense probably damaging 0.96
R1717:Nckap1 UTSW 2 80512670 splice site probably benign
R1789:Nckap1 UTSW 2 80520556 missense probably benign 0.44
R1822:Nckap1 UTSW 2 80517898 missense possibly damaging 0.58
R1840:Nckap1 UTSW 2 80502250 missense possibly damaging 0.88
R1926:Nckap1 UTSW 2 80506838 missense probably damaging 1.00
R1968:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1970:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R2027:Nckap1 UTSW 2 80535518 missense probably damaging 1.00
R2063:Nckap1 UTSW 2 80570150 missense probably damaging 1.00
R2504:Nckap1 UTSW 2 80530218 missense probably benign 0.40
R3824:Nckap1 UTSW 2 80540560 missense possibly damaging 0.72
R4784:Nckap1 UTSW 2 80506934 missense probably benign 0.15
R4908:Nckap1 UTSW 2 80523374 critical splice donor site probably null
R5077:Nckap1 UTSW 2 80548933 missense probably damaging 0.99
R5311:Nckap1 UTSW 2 80540122 missense probably damaging 1.00
R5439:Nckap1 UTSW 2 80512690 missense possibly damaging 0.81
R6141:Nckap1 UTSW 2 80530207 missense probably damaging 1.00
R6209:Nckap1 UTSW 2 80525602 missense probably damaging 1.00
R6226:Nckap1 UTSW 2 80508781 missense possibly damaging 0.96
R6294:Nckap1 UTSW 2 80541514 missense probably benign 0.03
R6458:Nckap1 UTSW 2 80512549 intron probably null
R6937:Nckap1 UTSW 2 80508716 missense probably damaging 1.00
R6986:Nckap1 UTSW 2 80520567 missense probably benign 0.03
R7180:Nckap1 UTSW 2 80506892 missense probably benign 0.01
R7208:Nckap1 UTSW 2 80540198 missense probably benign 0.24
R7363:Nckap1 UTSW 2 80540168 missense probably damaging 1.00
R7448:Nckap1 UTSW 2 80524541 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTGGCACCCATCTCACC -3'
(R):5'- GCTAATTGCATAAATTGCTCTGTGGGTT -3'

Sequencing Primer
(F):5'- AATGGGTACACTCCTCACATTG -3'
(R):5'- TGGGTTATGTGGTAAAAGAATTTCAG -3'
Posted On2013-11-08