Incidental Mutation 'R0924:Wdr19'
ID83071
Institutional Source Beutler Lab
Gene Symbol Wdr19
Ensembl Gene ENSMUSG00000037890
Gene NameWD repeat domain 19
Synonyms
MMRRC Submission 039071-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0924 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location65199696-65260415 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 65256439 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041892] [ENSMUST00000203653]
Predicted Effect probably benign
Transcript: ENSMUST00000041892
SMART Domains Protein: ENSMUSP00000038098
Gene: ENSMUSG00000037890

DomainStartEndE-ValueType
WD40 6 42 4.26e1 SMART
WD40 44 83 2.13e1 SMART
WD40 85 125 2.75e1 SMART
WD40 128 166 2.67e-1 SMART
Blast:WD40 220 258 6e-9 BLAST
WD40 264 302 1.46e-1 SMART
Blast:WD40 308 347 2e-18 BLAST
Pfam:WD40_3 508 564 2.7e-32 PFAM
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1259 1268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203359
Predicted Effect probably benign
Transcript: ENSMUST00000203554
Predicted Effect probably benign
Transcript: ENSMUST00000203653
SMART Domains Protein: ENSMUSP00000144866
Gene: ENSMUSG00000037890

DomainStartEndE-ValueType
WD40 6 42 4.26e1 SMART
WD40 44 83 2.13e1 SMART
WD40 85 125 2.75e1 SMART
WD40 128 166 2.67e-1 SMART
Blast:WD40 220 258 6e-9 BLAST
WD40 264 302 1.46e-1 SMART
Blast:WD40 308 347 2e-18 BLAST
Pfam:WD40_3 508 564 2.7e-32 PFAM
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1259 1268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD (tryptophan-aspartic acid) repeat family, which is a large family of structurally-related proteins known to participate in a wide range of cellular processes. Each WD repeat typically contains about 40 amino acids that are usually bracketed by glycine-histidine and tryptophan-aspartic acid (WD) dipeptides. This protein contains six WD repeats, three transmembrane domains, and a clathrin heavy-chain repeat. Mutations in this gene have been described in individuals with a wide range of disorders affecting function of the cilium. These disorders are known as ciliopathies, and include Jeune syndrome, Sensenbrenner syndromes, Senior-Loken syndrome, combined or isolated nephronophthisis (NPHP), and retinitis pigmentosa (RP). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,251,070 probably benign Het
9530053A07Rik A T 7: 28,140,130 Y456F probably damaging Het
Adamts18 A T 8: 113,705,396 probably null Het
Ahcyl2 A C 6: 29,870,628 probably null Het
Ajap1 T A 4: 153,386,472 I293F probably damaging Het
Akap10 T C 11: 61,904,863 probably benign Het
Aldh3b2 T C 19: 3,979,350 V241A probably benign Het
Anxa6 A T 11: 54,994,388 probably null Het
Atpaf1 T A 4: 115,795,438 V12D probably damaging Het
Aurkb C A 11: 69,045,996 Y12* probably null Het
Bicdl1 A G 5: 115,661,528 probably benign Het
Bnc1 A T 7: 81,978,408 probably benign Het
Bpi A G 2: 158,261,426 I114V possibly damaging Het
Cacna1c A T 6: 118,675,896 I772N probably damaging Het
Cacna2d1 A G 5: 16,365,862 N1045D possibly damaging Het
Ccrl2 A G 9: 111,055,968 V154A probably benign Het
Celsr3 C A 9: 108,846,025 Q2831K possibly damaging Het
Cul3 A T 1: 80,290,118 M102K probably damaging Het
Cwf19l2 T C 9: 3,441,047 probably benign Het
Dlg5 G A 14: 24,135,577 P1920L probably damaging Het
Dnah2 T C 11: 69,421,308 H4393R probably damaging Het
Eif2b3 T A 4: 117,081,578 V408D possibly damaging Het
Eml3 T C 19: 8,933,311 probably null Het
Enpp2 T C 15: 54,906,959 probably benign Het
Gm14178 T A 11: 99,747,500 T18S Het
H2-Bl A T 17: 36,083,932 V33E probably damaging Het
H2-M11 A G 17: 36,549,214 M324V probably benign Het
Hdac10 T C 15: 89,125,862 T298A probably benign Het
Hepacam A C 9: 37,383,928 probably benign Het
Hist1h2bk G A 13: 22,036,040 D52N probably damaging Het
Hmx3 A T 7: 131,543,084 H41L probably benign Het
Ifi27l2a A G 12: 103,442,380 V68A probably damaging Het
Itga11 A G 9: 62,776,674 E1079G probably benign Het
Krt6a T C 15: 101,690,800 probably benign Het
L1td1 A G 4: 98,737,625 N686D probably damaging Het
Lrrtm2 G A 18: 35,213,755 R165C probably damaging Het
Macf1 G T 4: 123,385,478 A3910E probably damaging Het
Muc5ac A T 7: 141,807,515 Y1521F possibly damaging Het
Myo7a A T 7: 98,098,256 I129N probably damaging Het
Ncam1 A T 9: 49,562,176 probably benign Het
Nckap1 A T 2: 80,554,249 C114S probably benign Het
Nf1 T G 11: 79,453,866 W1260G probably damaging Het
Olfr1415 A G 1: 92,491,405 S117P possibly damaging Het
Olfr411 T C 11: 74,346,798 Y262C probably damaging Het
Olfr813 A T 10: 129,856,646 I43F probably damaging Het
Oxtr A T 6: 112,489,637 probably null Het
Pabpc4 C T 4: 123,294,665 R356C possibly damaging Het
Pcbp2 T A 15: 102,489,762 D182E probably damaging Het
Pgm1 A T 5: 64,112,147 I526F possibly damaging Het
Rab43 A T 6: 87,792,770 Y151* probably null Het
Rbm19 A G 5: 120,126,204 E343G probably benign Het
Rel A T 11: 23,742,439 D531E probably benign Het
Rfx4 T A 10: 84,868,427 V262E probably damaging Het
Rnf31 T C 14: 55,593,002 probably benign Het
Robo3 T A 9: 37,429,482 probably benign Het
Ryr3 A G 2: 112,841,833 L1431P probably damaging Het
Sema3d A C 5: 12,463,216 D51A possibly damaging Het
Sema6a A G 18: 47,248,492 L996P probably damaging Het
Sh2d4a T A 8: 68,335,123 F294I probably damaging Het
Sorl1 T A 9: 42,008,174 probably benign Het
Sox1ot G T 8: 12,430,455 noncoding transcript Het
Spsb3 A T 17: 24,891,384 N395I probably damaging Het
Sptan1 A G 2: 30,016,028 N1662S probably damaging Het
Srd5a2 G T 17: 74,024,521 N160K probably damaging Het
Tmem132d G A 5: 127,984,439 probably benign Het
Tmem173 A G 18: 35,735,101 probably null Het
Unc80 A T 1: 66,510,641 Q686L possibly damaging Het
Vmn2r93 A G 17: 18,304,181 T146A probably benign Het
Zfp646 C T 7: 127,883,810 Q1500* probably null Het
Zfp683 T C 4: 134,055,827 Y201H probably benign Het
Other mutations in Wdr19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Wdr19 APN 5 65252299 missense probably benign 0.41
IGL01346:Wdr19 APN 5 65221739 splice site probably benign
IGL01761:Wdr19 APN 5 65215820 missense possibly damaging 0.60
IGL01845:Wdr19 APN 5 65225366 missense probably damaging 0.98
IGL01977:Wdr19 APN 5 65228569 missense probably benign
IGL02314:Wdr19 APN 5 65257120 missense probably benign 0.26
IGL02455:Wdr19 APN 5 65224759 missense probably benign 0.01
IGL02542:Wdr19 APN 5 65231071 missense probably benign
IGL02616:Wdr19 APN 5 65223581 missense probably damaging 0.97
IGL02661:Wdr19 APN 5 65245808 missense probably benign 0.06
IGL02927:Wdr19 APN 5 65252378 missense possibly damaging 0.80
IGL02958:Wdr19 APN 5 65212807 splice site probably null
IGL03083:Wdr19 APN 5 65230976 missense probably benign 0.01
IGL03332:Wdr19 APN 5 65227143 missense possibly damaging 0.89
R1178:Wdr19 UTSW 5 65223865 missense probably damaging 0.98
R1229:Wdr19 UTSW 5 65256391 missense possibly damaging 0.94
R1434:Wdr19 UTSW 5 65223504 splice site probably benign
R1543:Wdr19 UTSW 5 65224690 missense probably benign 0.06
R1819:Wdr19 UTSW 5 65212891 missense possibly damaging 0.59
R1971:Wdr19 UTSW 5 65241160 splice site probably benign
R2190:Wdr19 UTSW 5 65244166 missense possibly damaging 0.89
R2274:Wdr19 UTSW 5 65240991 missense possibly damaging 0.62
R3106:Wdr19 UTSW 5 65202623 missense probably benign 0.20
R3753:Wdr19 UTSW 5 65224726 missense probably damaging 1.00
R3893:Wdr19 UTSW 5 65228292 missense possibly damaging 0.64
R4609:Wdr19 UTSW 5 65228542 missense possibly damaging 0.83
R5284:Wdr19 UTSW 5 65225409 missense probably damaging 1.00
R5328:Wdr19 UTSW 5 65244179 missense probably damaging 1.00
R5530:Wdr19 UTSW 5 65228219 missense probably benign
R5837:Wdr19 UTSW 5 65202957 missense probably benign 0.08
R5902:Wdr19 UTSW 5 65227139 missense probably benign 0.09
R6065:Wdr19 UTSW 5 65221713 missense probably benign
R6419:Wdr19 UTSW 5 65215893 missense possibly damaging 0.63
R6495:Wdr19 UTSW 5 65258123 missense probably benign 0.00
R6916:Wdr19 UTSW 5 65225334 missense possibly damaging 0.64
R7020:Wdr19 UTSW 5 65256314 missense probably damaging 0.99
X0028:Wdr19 UTSW 5 65244144 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCTTGCAGACATCGTGCCTATCC -3'
(R):5'- ACAGACCTTTTCAGGCCAGTGAGC -3'

Sequencing Primer
(F):5'- GACATCGTGCCTATCCTGACG -3'
(R):5'- catccagtatggtggctatgag -3'
Posted On2013-11-08