Incidental Mutation 'R0925:Smc4'
ID83132
Institutional Source Beutler Lab
Gene Symbol Smc4
Ensembl Gene ENSMUSG00000034349
Gene Namestructural maintenance of chromosomes 4
Synonyms2500002A22Rik, Smc4l1
MMRRC Submission 039072-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.985) question?
Stock #R0925 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location69004738-69034623 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) T to A at 69006215 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042901] [ENSMUST00000107803] [ENSMUST00000107812] [ENSMUST00000136502] [ENSMUST00000148031] [ENSMUST00000148385] [ENSMUST00000154741] [ENSMUST00000169064] [ENSMUST00000195525]
Predicted Effect probably benign
Transcript: ENSMUST00000042901
SMART Domains Protein: ENSMUSP00000047872
Gene: ENSMUSG00000034349

DomainStartEndE-ValueType
PDB:1W1W|D 89 238 1e-17 PDB
Blast:AAA 104 238 3e-6 BLAST
low complexity region 408 427 N/A INTRINSIC
low complexity region 447 460 N/A INTRINSIC
low complexity region 473 482 N/A INTRINSIC
low complexity region 545 567 N/A INTRINSIC
SMC_hinge 611 726 1.12e-31 SMART
low complexity region 870 881 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
Blast:AAA 1102 1276 5e-26 BLAST
PDB:3KTA|D 1125 1276 3e-30 PDB
SCOP:d1e69a_ 1188 1263 3e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083672
Predicted Effect probably benign
Transcript: ENSMUST00000107803
SMART Domains Protein: ENSMUSP00000103433
Gene: ENSMUSG00000034349

DomainStartEndE-ValueType
Pfam:AAA_23 59 329 1.3e-12 PFAM
Pfam:AAA_21 81 199 5.2e-7 PFAM
coiled coil region 369 482 N/A INTRINSIC
coiled coil region 511 563 N/A INTRINSIC
SMC_hinge 586 701 8.6e-36 SMART
Pfam:SMC_N 738 1247 1.1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107812
SMART Domains Protein: ENSMUSP00000103442
Gene: ENSMUSG00000027778

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136448
Predicted Effect probably benign
Transcript: ENSMUST00000136502
SMART Domains Protein: ENSMUSP00000115033
Gene: ENSMUSG00000034349

DomainStartEndE-ValueType
Pfam:SMC_N 81 303 1.2e-42 PFAM
Pfam:AAA_23 84 336 2.6e-16 PFAM
Pfam:AAA_21 106 227 1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148031
SMART Domains Protein: ENSMUSP00000122919
Gene: ENSMUSG00000027778

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 3e-10 BLAST
WD40 95 134 9.38e-5 SMART
Blast:WD40 136 159 1e-8 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000148385
AA Change: S45R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152502
Predicted Effect probably benign
Transcript: ENSMUST00000154741
SMART Domains Protein: ENSMUSP00000118406
Gene: ENSMUSG00000027778

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 9e-10 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 209 2.12e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169064
SMART Domains Protein: ENSMUSP00000133263
Gene: ENSMUSG00000027778

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192467
Predicted Effect probably benign
Transcript: ENSMUST00000195525
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the 'structural maintenance of chromosomes' (SMC) gene family. Members of this gene family play a role in two changes in chromosome structure during mitotic segregation of chromosomes- chromosome condensation and sister chromatid cohesion. The protein encoded by this gene is likely a subunit of the 13S condensin complex, which is involved in chromosome condensation. A pseudogene related to this gene is located on chromosome 2. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T A 2: 173,526,074 S47T probably benign Het
Adam5 T C 8: 24,812,425 Q101R probably benign Het
C2cd4c T C 10: 79,612,750 N188D probably benign Het
Cdc27 A G 11: 104,526,049 probably null Het
Cdh11 T A 8: 102,634,724 I661L probably damaging Het
Csmd1 A G 8: 16,710,618 I167T probably benign Het
Dennd3 T G 15: 73,533,435 F346V probably damaging Het
Dis3l A T 9: 64,341,130 M1K probably null Het
Dnajb6 A T 5: 29,752,400 K60I probably damaging Het
Dock10 T A 1: 80,536,940 H1421L probably benign Het
Elmod3 A T 6: 72,568,938 C274S probably damaging Het
Eme1 T C 11: 94,650,732 E88G probably damaging Het
Fam227a A T 15: 79,620,805 M475K probably benign Het
Frem2 T C 3: 53,653,973 I1038V probably benign Het
Gabpb1 T A 2: 126,652,265 N147Y probably damaging Het
Gm5346 T C 8: 43,626,303 I295V probably benign Het
Gmnc A G 16: 26,960,423 L278P probably benign Het
Gpr153 A G 4: 152,281,874 T299A probably benign Het
H2-M11 T C 17: 36,547,461 V49A probably benign Het
Hemgn T A 4: 46,397,049 K62N probably damaging Het
Hormad2 G A 11: 4,427,297 T47M probably damaging Het
Iqcf6 A G 9: 106,627,301 T55A probably benign Het
Itgam T C 7: 128,112,238 F705L probably benign Het
Klk1 T A 7: 44,228,816 probably null Het
Myo1f A T 17: 33,578,133 I123F probably damaging Het
Nupl1 T C 14: 60,220,141 T538A probably damaging Het
Olfr510 C T 7: 108,668,193 T259I probably benign Het
Olfr592 T A 7: 103,186,823 L74* probably null Het
Pdzd2 C T 15: 12,399,270 R790H probably damaging Het
Pigv T C 4: 133,662,649 K74R probably benign Het
Prmt8 T C 6: 127,697,813 K284R probably benign Het
Rsl1d1 A T 16: 11,199,689 Y138N probably damaging Het
Scara5 AC ACC 14: 65,762,718 probably benign Het
Spta1 G A 1: 174,174,426 V41I possibly damaging Het
Tdrd7 C A 4: 46,025,758 N859K probably damaging Het
Vps13d T G 4: 145,156,551 D824A probably damaging Het
Wdfy2 A T 14: 62,930,226 probably null Het
Other mutations in Smc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Smc4 APN 3 69030379 missense probably damaging 0.98
IGL00542:Smc4 APN 3 69028438 splice site probably benign
IGL01104:Smc4 APN 3 69027584 missense possibly damaging 0.95
IGL01380:Smc4 APN 3 69025828 missense probably damaging 1.00
IGL01397:Smc4 APN 3 69031544 missense probably benign
IGL02441:Smc4 APN 3 69006211 missense probably damaging 1.00
IGL02629:Smc4 APN 3 69025873 missense probably damaging 0.96
IGL03220:Smc4 APN 3 69009542 missense possibly damaging 0.67
R0452:Smc4 UTSW 3 69008028 nonsense probably null
R0523:Smc4 UTSW 3 69025888 missense probably damaging 1.00
R0568:Smc4 UTSW 3 69022461 critical splice donor site probably null
R0571:Smc4 UTSW 3 69024289 missense probably damaging 1.00
R0602:Smc4 UTSW 3 69009538 missense probably damaging 1.00
R0963:Smc4 UTSW 3 69025926 missense probably damaging 1.00
R1540:Smc4 UTSW 3 69016772 missense probably damaging 1.00
R1755:Smc4 UTSW 3 69034108 missense probably damaging 1.00
R1920:Smc4 UTSW 3 69033068 missense probably damaging 1.00
R4226:Smc4 UTSW 3 69031467 missense probably benign 0.01
R4510:Smc4 UTSW 3 69016647 splice site probably null
R4511:Smc4 UTSW 3 69016647 splice site probably null
R4899:Smc4 UTSW 3 69031811 missense probably damaging 0.97
R4967:Smc4 UTSW 3 69018239 intron probably benign
R5096:Smc4 UTSW 3 69021279 missense probably damaging 1.00
R5101:Smc4 UTSW 3 69028512 missense probably benign 0.00
R5588:Smc4 UTSW 3 69025857 missense probably benign
R5631:Smc4 UTSW 3 69030312 missense probably benign 0.16
R5633:Smc4 UTSW 3 69008110 missense probably damaging 1.00
R6229:Smc4 UTSW 3 69030247 nonsense probably null
R6300:Smc4 UTSW 3 69027891 missense probably benign 0.00
R6554:Smc4 UTSW 3 69029515 missense probably benign 0.00
R6596:Smc4 UTSW 3 69025893 missense probably damaging 1.00
R6603:Smc4 UTSW 3 69022461 critical splice donor site probably null
R6682:Smc4 UTSW 3 69007241 missense probably damaging 0.98
R6727:Smc4 UTSW 3 69016772 missense probably damaging 1.00
R6955:Smc4 UTSW 3 69024309 missense possibly damaging 0.95
R7037:Smc4 UTSW 3 69018195 missense possibly damaging 0.67
R7051:Smc4 UTSW 3 69027502 missense probably damaging 1.00
X0063:Smc4 UTSW 3 69018103 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TTATGAGATGGTTCCACAGGGGCG -3'
(R):5'- CACATTCACTCCAGTCTAAGGGCG -3'

Sequencing Primer
(F):5'- TGGCCTGAGCGAATTCCTC -3'
(R):5'- CCGCTTTCAGCGGAAATATG -3'
Posted On2013-11-08