Incidental Mutation 'R0926:Cntn4'
ID83196
Institutional Source Beutler Lab
Gene Symbol Cntn4
Ensembl Gene ENSMUSG00000064293
Gene Namecontactin 4
SynonymsBIG-2A, Axcam
MMRRC Submission 039073-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.519) question?
Stock #R0926 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location105677660-106699310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106655581 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 522 (T522I)
Ref Sequence ENSEMBL: ENSMUSP00000108889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079416] [ENSMUST00000089208] [ENSMUST00000113260] [ENSMUST00000113261] [ENSMUST00000113264]
Predicted Effect probably benign
Transcript: ENSMUST00000079416
AA Change: T522I

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000078385
Gene: ENSMUSG00000064293
AA Change: T522I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089208
AA Change: T522I

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000086616
Gene: ENSMUSG00000064293
AA Change: T522I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
FN3 700 786 8.39e0 SMART
FN3 801 886 1.33e-6 SMART
FN3 901 981 9.85e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113260
AA Change: T522I

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108885
Gene: ENSMUSG00000064293
AA Change: T522I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113261
AA Change: T522I

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108886
Gene: ENSMUSG00000064293
AA Change: T522I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113264
AA Change: T522I

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108889
Gene: ENSMUSG00000064293
AA Change: T522I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
FN3 700 786 8.39e0 SMART
FN3 801 886 1.33e-6 SMART
FN3 901 981 9.85e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204621
Meta Mutation Damage Score 0.1132 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the contactin family of immunoglobulins. Contactins are axon-associated cell adhesion molecules that function in neuronal network formation and plasticity. The encoded protein is a glycosylphosphatidylinositol-anchored neuronal membrane protein that may play a role in the formation of axon connections in the developing nervous system. Deletion or mutation of this gene may play a role in 3p deletion syndrome and autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit aberrant projection of olfactory axons to multiple glomeruli in the olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,257,549 D514G probably damaging Het
Acbd7 A T 2: 3,340,441 I41F possibly damaging Het
Actr8 G T 14: 29,987,224 V262L probably benign Het
Anp32e A G 3: 95,937,142 D108G probably damaging Het
Banp G A 8: 122,020,555 G448S probably benign Het
Camsap3 G A 8: 3,587,960 probably null Het
Cd22 C A 7: 30,869,509 probably null Het
Cfap58 A T 19: 47,962,562 Q454L probably damaging Het
Col11a1 G A 3: 114,090,180 D233N unknown Het
Csmd1 G T 8: 16,033,576 probably null Het
Csmd3 T A 15: 47,977,033 Y946F probably damaging Het
D5Ertd579e G T 5: 36,672,866 P38Q probably damaging Het
Dnal4 T C 15: 79,762,025 T93A probably benign Het
Dsp A T 13: 38,183,218 D614V probably damaging Het
Fam160b1 G A 19: 57,381,090 A383T probably damaging Het
Fcgr1 A T 3: 96,292,366 I75N possibly damaging Het
Fgd6 T A 10: 94,135,047 Y1229N probably benign Het
Frmpd1 T G 4: 45,268,497 L214R probably damaging Het
Gapvd1 A T 2: 34,712,325 D603E probably damaging Het
H2-M9 A G 17: 36,641,773 V127A probably damaging Het
Herc2 T A 7: 56,132,548 S1328T possibly damaging Het
Ica1l T C 1: 60,006,297 N269S probably benign Het
Il18r1 T C 1: 40,487,028 Y245H probably damaging Het
Il6ra A T 3: 89,887,069 V195E probably damaging Het
Inpp5j A G 11: 3,501,439 probably benign Het
Isy1 T C 6: 87,819,143 T271A probably benign Het
Klra9 T C 6: 130,179,030 Y254C probably damaging Het
Ly6e T G 15: 74,958,370 S73A probably damaging Het
Mcmdc2 T A 1: 9,920,576 L326* probably null Het
Muc4 G A 16: 32,756,196 probably benign Het
Myh3 A G 11: 67,090,514 probably null Het
Ndor1 G A 2: 25,248,348 H409Y probably benign Het
Nwd2 A G 5: 63,807,891 D1606G probably damaging Het
Olfr1156 A T 2: 87,949,922 F104I probably damaging Het
Olfr1303 A G 2: 111,814,547 Y60H probably damaging Het
Olfr1451 A T 19: 12,999,190 D68V probably damaging Het
Olfr186 A G 16: 59,027,688 I73T possibly damaging Het
Olfr314 A G 11: 58,787,109 N292D probably damaging Het
Olfr411 G A 11: 74,347,306 R93C probably benign Het
Olfr585 T C 7: 103,097,885 L48P probably damaging Het
Paox C A 7: 140,134,038 T237K probably damaging Het
Pcmtd1 T A 1: 7,161,019 L4I probably damaging Het
Pfkl T A 10: 78,000,689 T165S probably damaging Het
Pik3ap1 A G 19: 41,302,525 S523P probably benign Het
Pitpnm1 A G 19: 4,112,338 D1056G probably damaging Het
Pitpnm2 G A 5: 124,131,209 T450I probably benign Het
Pou2f3 T C 9: 43,146,901 D37G probably damaging Het
Prdm5 A G 6: 65,883,547 H221R probably damaging Het
Pwp1 T A 10: 85,876,514 I72N probably damaging Het
Rhou A G 8: 123,660,976 E149G probably damaging Het
She A G 3: 89,851,594 probably benign Het
Slc26a9 A C 1: 131,753,216 H121P probably benign Het
Spag17 A G 3: 100,072,116 D1431G probably benign Het
Trpm3 A T 19: 22,988,043 D1634V probably benign Het
Ttn A G 2: 76,797,227 probably benign Het
Zc3h14 T A 12: 98,758,590 D170E possibly damaging Het
Zcrb1 T C 15: 93,391,528 K51E probably damaging Het
Zfp110 C T 7: 12,849,881 Q819* probably null Het
Zfp616 A G 11: 74,085,818 N971S probably benign Het
Zfp827 A T 8: 79,118,192 T664S probably benign Het
Other mutations in Cntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cntn4 APN 6 106506225 missense probably damaging 1.00
IGL00725:Cntn4 APN 6 106662655 missense probably damaging 1.00
IGL01062:Cntn4 APN 6 106618278 splice site probably benign
IGL01432:Cntn4 APN 6 106678334 splice site probably benign
IGL01585:Cntn4 APN 6 106618328 nonsense probably null
IGL01710:Cntn4 APN 6 106550431 missense possibly damaging 0.87
IGL01870:Cntn4 APN 6 106489715 missense possibly damaging 0.95
IGL01933:Cntn4 APN 6 106694384 missense probably damaging 0.99
IGL01937:Cntn4 APN 6 106437904 missense probably damaging 1.00
IGL01945:Cntn4 APN 6 106437904 missense probably damaging 1.00
IGL02007:Cntn4 APN 6 106655529 missense probably benign 0.03
IGL02506:Cntn4 APN 6 106618388 missense probably benign 0.24
IGL02561:Cntn4 APN 6 106523509 missense probably damaging 1.00
IGL03080:Cntn4 APN 6 106655539 missense probably damaging 1.00
IGL03338:Cntn4 APN 6 106655589 missense probably damaging 0.98
IGL03097:Cntn4 UTSW 6 106353712 missense probably benign 0.10
LCD18:Cntn4 UTSW 6 106553940 intron probably benign
R0083:Cntn4 UTSW 6 106525369 missense possibly damaging 0.79
R0098:Cntn4 UTSW 6 106618424 splice site probably benign
R0501:Cntn4 UTSW 6 106618335 missense probably damaging 1.00
R0626:Cntn4 UTSW 6 106662578 missense probably benign 0.07
R0633:Cntn4 UTSW 6 106679248 splice site probably null
R0730:Cntn4 UTSW 6 106550486 missense probably damaging 1.00
R0849:Cntn4 UTSW 6 106667457 missense probably damaging 1.00
R0883:Cntn4 UTSW 6 106667540 splice site probably benign
R1199:Cntn4 UTSW 6 106353597 splice site probably benign
R1293:Cntn4 UTSW 6 106353724 missense probably benign 0.00
R1296:Cntn4 UTSW 6 106509402 missense probably damaging 1.00
R1344:Cntn4 UTSW 6 106344870 splice site probably null
R1418:Cntn4 UTSW 6 106344870 splice site probably null
R1660:Cntn4 UTSW 6 106679297 missense probably benign 0.35
R1751:Cntn4 UTSW 6 106618410 critical splice donor site probably null
R1883:Cntn4 UTSW 6 106679392 missense probably benign 0.01
R1884:Cntn4 UTSW 6 106679392 missense probably benign 0.01
R1899:Cntn4 UTSW 6 106675813 missense probably benign 0.21
R1906:Cntn4 UTSW 6 106353646 missense probably benign 0.00
R2048:Cntn4 UTSW 6 106437864 splice site probably benign
R2113:Cntn4 UTSW 6 106489697 missense probably damaging 1.00
R3177:Cntn4 UTSW 6 106437964 critical splice donor site probably null
R3277:Cntn4 UTSW 6 106437964 critical splice donor site probably null
R3944:Cntn4 UTSW 6 106618414 missense probably benign 0.10
R4401:Cntn4 UTSW 6 106489664 missense possibly damaging 0.94
R4540:Cntn4 UTSW 6 106675748 missense probably damaging 1.00
R4688:Cntn4 UTSW 6 106437949 missense probably damaging 1.00
R4697:Cntn4 UTSW 6 106525485 missense probably damaging 1.00
R4810:Cntn4 UTSW 6 106655611 missense probably benign 0.04
R4816:Cntn4 UTSW 6 106550497 missense probably benign
R4873:Cntn4 UTSW 6 106437913 missense possibly damaging 0.61
R4875:Cntn4 UTSW 6 106437913 missense possibly damaging 0.61
R4953:Cntn4 UTSW 6 106525418 missense probably benign 0.01
R5288:Cntn4 UTSW 6 106181804 missense possibly damaging 0.60
R5336:Cntn4 UTSW 6 106662634 missense possibly damaging 0.72
R5386:Cntn4 UTSW 6 106181804 missense possibly damaging 0.60
R5477:Cntn4 UTSW 6 106673950 missense possibly damaging 0.88
R5514:Cntn4 UTSW 6 106672883 missense probably damaging 1.00
R5668:Cntn4 UTSW 6 106679436 splice site silent
R6334:Cntn4 UTSW 6 106344786 missense probably benign
R6334:Cntn4 UTSW 6 106506192 missense probably benign 0.29
R6904:Cntn4 UTSW 6 106697583 missense probably benign 0.03
R6985:Cntn4 UTSW 6 106679417 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCCACATAAAGTTAGTTGTTGTTGCTG -3'
(R):5'- AGGCATTTTACATAACTCCTACGAACCC -3'

Sequencing Primer
(F):5'- ggtggtgctggagattgaatg -3'
(R):5'- GCGTTCTGTGAAATAAGATGCTACC -3'
Posted On2013-11-08