Incidental Mutation 'R0926:1700017B05Rik'
ID83210
Institutional Source Beutler Lab
Gene Symbol 1700017B05Rik
Ensembl Gene ENSMUSG00000032300
Gene NameRIKEN cDNA 1700017B05 gene
SynonymsD9Ertd278e
MMRRC Submission 039073-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R0926 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57253117-57262612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57257549 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 514 (D514G)
Ref Sequence ENSEMBL: ENSMUSP00000150884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034846] [ENSMUST00000213199] [ENSMUST00000215298] [ENSMUST00000217657]
Predicted Effect probably damaging
Transcript: ENSMUST00000034846
AA Change: D514G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034846
Gene: ENSMUSG00000032300
AA Change: D514G

DomainStartEndE-ValueType
low complexity region 265 284 N/A INTRINSIC
low complexity region 293 299 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
low complexity region 649 675 N/A INTRINSIC
low complexity region 692 728 N/A INTRINSIC
low complexity region 785 799 N/A INTRINSIC
low complexity region 933 951 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213199
AA Change: D514G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214583
Predicted Effect probably benign
Transcript: ENSMUST00000215298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215426
Predicted Effect probably benign
Transcript: ENSMUST00000217657
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd7 A T 2: 3,340,441 I41F possibly damaging Het
Actr8 G T 14: 29,987,224 V262L probably benign Het
Anp32e A G 3: 95,937,142 D108G probably damaging Het
Banp G A 8: 122,020,555 G448S probably benign Het
Camsap3 G A 8: 3,587,960 probably null Het
Cd22 C A 7: 30,869,509 probably null Het
Cfap58 A T 19: 47,962,562 Q454L probably damaging Het
Cntn4 C T 6: 106,655,581 T522I probably benign Het
Col11a1 G A 3: 114,090,180 D233N unknown Het
Csmd1 G T 8: 16,033,576 probably null Het
Csmd3 T A 15: 47,977,033 Y946F probably damaging Het
D5Ertd579e G T 5: 36,672,866 P38Q probably damaging Het
Dnal4 T C 15: 79,762,025 T93A probably benign Het
Dsp A T 13: 38,183,218 D614V probably damaging Het
Fam160b1 G A 19: 57,381,090 A383T probably damaging Het
Fcgr1 A T 3: 96,292,366 I75N possibly damaging Het
Fgd6 T A 10: 94,135,047 Y1229N probably benign Het
Frmpd1 T G 4: 45,268,497 L214R probably damaging Het
Gapvd1 A T 2: 34,712,325 D603E probably damaging Het
H2-M9 A G 17: 36,641,773 V127A probably damaging Het
Herc2 T A 7: 56,132,548 S1328T possibly damaging Het
Ica1l T C 1: 60,006,297 N269S probably benign Het
Il18r1 T C 1: 40,487,028 Y245H probably damaging Het
Il6ra A T 3: 89,887,069 V195E probably damaging Het
Inpp5j A G 11: 3,501,439 probably benign Het
Isy1 T C 6: 87,819,143 T271A probably benign Het
Klra9 T C 6: 130,179,030 Y254C probably damaging Het
Ly6e T G 15: 74,958,370 S73A probably damaging Het
Mcmdc2 T A 1: 9,920,576 L326* probably null Het
Muc4 G A 16: 32,756,196 probably benign Het
Myh3 A G 11: 67,090,514 probably null Het
Ndor1 G A 2: 25,248,348 H409Y probably benign Het
Nwd2 A G 5: 63,807,891 D1606G probably damaging Het
Olfr1156 A T 2: 87,949,922 F104I probably damaging Het
Olfr1303 A G 2: 111,814,547 Y60H probably damaging Het
Olfr1451 A T 19: 12,999,190 D68V probably damaging Het
Olfr186 A G 16: 59,027,688 I73T possibly damaging Het
Olfr314 A G 11: 58,787,109 N292D probably damaging Het
Olfr411 G A 11: 74,347,306 R93C probably benign Het
Olfr585 T C 7: 103,097,885 L48P probably damaging Het
Paox C A 7: 140,134,038 T237K probably damaging Het
Pcmtd1 T A 1: 7,161,019 L4I probably damaging Het
Pfkl T A 10: 78,000,689 T165S probably damaging Het
Pik3ap1 A G 19: 41,302,525 S523P probably benign Het
Pitpnm1 A G 19: 4,112,338 D1056G probably damaging Het
Pitpnm2 G A 5: 124,131,209 T450I probably benign Het
Pou2f3 T C 9: 43,146,901 D37G probably damaging Het
Prdm5 A G 6: 65,883,547 H221R probably damaging Het
Pwp1 T A 10: 85,876,514 I72N probably damaging Het
Rhou A G 8: 123,660,976 E149G probably damaging Het
She A G 3: 89,851,594 probably benign Het
Slc26a9 A C 1: 131,753,216 H121P probably benign Het
Spag17 A G 3: 100,072,116 D1431G probably benign Het
Trpm3 A T 19: 22,988,043 D1634V probably benign Het
Ttn A G 2: 76,797,227 probably benign Het
Zc3h14 T A 12: 98,758,590 D170E possibly damaging Het
Zcrb1 T C 15: 93,391,528 K51E probably damaging Het
Zfp110 C T 7: 12,849,881 Q819* probably null Het
Zfp616 A G 11: 74,085,818 N971S probably benign Het
Zfp827 A T 8: 79,118,192 T664S probably benign Het
Other mutations in 1700017B05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:1700017B05Rik APN 9 57258246 missense probably damaging 1.00
IGL01287:1700017B05Rik APN 9 57257757 missense probably damaging 1.00
IGL01798:1700017B05Rik APN 9 57256638 missense probably benign 0.10
IGL01933:1700017B05Rik APN 9 57257367 missense possibly damaging 0.95
IGL02146:1700017B05Rik APN 9 57256740 missense possibly damaging 0.82
IGL02158:1700017B05Rik APN 9 57256619 unclassified probably null
IGL02277:1700017B05Rik APN 9 57258425 missense probably benign 0.05
IGL02707:1700017B05Rik APN 9 57258645 missense probably benign
IGL02887:1700017B05Rik APN 9 57258885 missense probably damaging 1.00
IGL02936:1700017B05Rik APN 9 57258404 missense possibly damaging 0.69
R0583:1700017B05Rik UTSW 9 57257643 missense probably benign 0.04
R1812:1700017B05Rik UTSW 9 57257457 nonsense probably null
R1903:1700017B05Rik UTSW 9 57258352 missense possibly damaging 0.69
R4542:1700017B05Rik UTSW 9 57256592 missense probably damaging 1.00
R4596:1700017B05Rik UTSW 9 57257805 missense probably benign 0.03
R4631:1700017B05Rik UTSW 9 57257987 missense probably damaging 1.00
R4869:1700017B05Rik UTSW 9 57254205 missense probably damaging 1.00
R5265:1700017B05Rik UTSW 9 57258894 missense probably damaging 1.00
R5361:1700017B05Rik UTSW 9 57257185 missense probably damaging 1.00
R6216:1700017B05Rik UTSW 9 57257627 missense probably benign 0.33
R6356:1700017B05Rik UTSW 9 57254009 missense probably benign 0.11
R6579:1700017B05Rik UTSW 9 57254224 missense possibly damaging 0.89
R6774:1700017B05Rik UTSW 9 57256625 missense probably damaging 1.00
R6921:1700017B05Rik UTSW 9 57258736 missense probably damaging 1.00
R7089:1700017B05Rik UTSW 9 57258758 missense probably damaging 1.00
R7196:1700017B05Rik UTSW 9 57258222 frame shift probably null
R7197:1700017B05Rik UTSW 9 57258222 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTCAGCGGGCTTTTCATGCACC -3'
(R):5'- GCGTCCTGGAGTGCCTATTGTTATC -3'

Sequencing Primer
(F):5'- TTCATGCACCTCAGGACTG -3'
(R):5'- CTATTGTTATCCGGGACAGTCCAG -3'
Posted On2013-11-08