Incidental Mutation 'R0905:Lgsn'
ID83269
Institutional Source Beutler Lab
Gene Symbol Lgsn
Ensembl Gene ENSMUSG00000050217
Gene Namelengsin, lens protein with glutamine synthetase domain
Synonymslengsin, Lgs, Gluld1
MMRRC Submission 039063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R0905 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location31176401-31204725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31203743 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 302 (Y302F)
Ref Sequence ENSEMBL: ENSMUSP00000059871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062560] [ENSMUST00000127775] [ENSMUST00000135245] [ENSMUST00000187659]
PDB Structure
Lengsin is a survivor of an ancient family of class I glutamine synthetases in eukaryotes that has undergone evolutionary re- engineering for a tissue-specific role in the vertebrate eye lens. [ELECTRON MICROSCOPY]
Predicted Effect probably damaging
Transcript: ENSMUST00000062560
AA Change: Y302F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059871
Gene: ENSMUSG00000050217
AA Change: Y302F

DomainStartEndE-ValueType
SCOP:d1f52a1 128 233 2e-20 SMART
Gln-synt_C 235 481 1.67e-39 SMART
low complexity region 483 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127775
SMART Domains Protein: ENSMUSP00000120381
Gene: ENSMUSG00000086727

DomainStartEndE-ValueType
low complexity region 55 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135245
SMART Domains Protein: ENSMUSP00000120289
Gene: ENSMUSG00000086727

DomainStartEndE-ValueType
low complexity region 55 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161773
Predicted Effect probably benign
Transcript: ENSMUST00000187659
SMART Domains Protein: ENSMUSP00000139710
Gene: ENSMUSG00000086727

DomainStartEndE-ValueType
low complexity region 55 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187892
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to the GS I members of the glutamine synthetase superfamily. The encoded protein is referred to as a pseudo-glutamine synthetase because it has no glutamine synthesis activity and may function as a chaperone protein. This protein is localized to the lens and may be associated with cataract disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G A 2: 20,849,934 T1539M possibly damaging Het
Birc3 A T 9: 7,851,051 *138R probably null Het
Bsn C A 9: 108,105,635 D3640Y unknown Het
Bsph1 A T 7: 13,450,914 M1L probably benign Het
Cdkl1 A T 12: 69,756,564 Y179* probably null Het
Cfap74 G A 4: 155,418,696 probably null Het
Crtc1 A T 8: 70,391,255 S454T probably damaging Het
Cspg5 A T 9: 110,246,526 D110V probably damaging Het
Cyp2w1 A T 5: 139,356,439 Y380F probably benign Het
Dbn1 T C 13: 55,474,227 probably benign Het
Epb41l4b T C 4: 57,103,528 K103E probably damaging Het
Eps8 C T 6: 137,514,307 V358I probably benign Het
Gm12253 G T 11: 58,440,020 probably benign Het
Hltf T A 3: 20,108,869 probably null Het
Hsd17b11 C T 5: 104,009,878 V123I probably benign Het
Il31ra T A 13: 112,531,673 E481V probably damaging Het
Impdh2 A G 9: 108,561,097 probably benign Het
Itih5 G A 2: 10,249,188 R750Q probably benign Het
Kndc1 A C 7: 139,923,735 K985T possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrp1b A G 2: 41,284,185 S1541P probably damaging Het
Mast4 A G 13: 102,770,784 M528T probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Ndufs2 T C 1: 171,236,353 probably null Het
Nwd1 G A 8: 72,709,449 V1436M probably damaging Het
Phf12 C T 11: 78,009,404 R109* probably null Het
Pml A G 9: 58,249,539 probably null Het
Ppfia2 T C 10: 106,819,511 I313T probably benign Het
Prdm14 C T 1: 13,125,438 G133D probably benign Het
Pygl A G 12: 70,211,017 probably benign Het
Rassf10 C T 7: 112,955,368 T392M probably damaging Het
Rpe65 T C 3: 159,601,583 S54P possibly damaging Het
Sema5b T C 16: 35,622,631 V2A probably benign Het
Sgsm3 T C 15: 81,011,345 I699T probably damaging Het
Spn T C 7: 127,136,331 T335A probably damaging Het
Tecta T C 9: 42,338,994 D1834G probably damaging Het
Trp53bp1 C A 2: 121,204,318 probably benign Het
Ttc3 A T 16: 94,456,789 K1652* probably null Het
Zadh2 A G 18: 84,095,207 H336R probably benign Het
Other mutations in Lgsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Lgsn APN 1 31203566 missense possibly damaging 0.75
IGL01347:Lgsn APN 1 31203960 missense probably damaging 1.00
IGL01688:Lgsn APN 1 31204405 missense probably damaging 1.00
IGL02937:Lgsn APN 1 31204237 missense possibly damaging 0.63
IGL03056:Lgsn APN 1 31203624 nonsense probably null
R0026:Lgsn UTSW 1 31203443 missense probably damaging 0.99
R0026:Lgsn UTSW 1 31203443 missense probably damaging 0.99
R0042:Lgsn UTSW 1 31190453 missense probably benign
R0042:Lgsn UTSW 1 31190453 missense probably benign
R0611:Lgsn UTSW 1 31203655 missense probably benign 0.01
R2248:Lgsn UTSW 1 31203526 missense possibly damaging 0.71
R3883:Lgsn UTSW 1 31176459 missense probably benign 0.00
R4782:Lgsn UTSW 1 31203742 missense probably benign 0.44
R5560:Lgsn UTSW 1 31196872 missense probably damaging 1.00
R6011:Lgsn UTSW 1 31203766 missense probably damaging 1.00
R6998:Lgsn UTSW 1 31204193 missense probably benign 0.20
R7003:Lgsn UTSW 1 31203943 missense possibly damaging 0.46
R7007:Lgsn UTSW 1 31190427 missense probably benign 0.00
R7282:Lgsn UTSW 1 31203371 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGTCCTCATGCCAGAGCTGTCG -3'
(R):5'- GCAGAACATATTTGTCTTCCCGCCC -3'

Sequencing Primer
(F):5'- TGTGACACCTTCACAGTGACG -3'
(R):5'- TCCTGAATTGCAGAATCCAGTC -3'
Posted On2013-11-08