Incidental Mutation 'R0905:Epb41l4b'
ID83278
Institutional Source Beutler Lab
Gene Symbol Epb41l4b
Ensembl Gene ENSMUSG00000028434
Gene Nameerythrocyte membrane protein band 4.1 like 4b
Synonyms6430543G08Rik, D4Ertd346e, Lulu2, Epb4.1l4b, Ehm2
MMRRC Submission 039063-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0905 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location56991972-57143437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57103528 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 103 (K103E)
Ref Sequence ENSEMBL: ENSMUSP00000030142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030142] [ENSMUST00000095076]
Predicted Effect probably damaging
Transcript: ENSMUST00000030142
AA Change: K103E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030142
Gene: ENSMUSG00000028434
AA Change: K103E

DomainStartEndE-ValueType
low complexity region 18 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
B41 81 277 4.09e-69 SMART
FERM_C 281 373 1.76e-35 SMART
FA 378 422 2.86e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095076
AA Change: K103E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092687
Gene: ENSMUSG00000028434
AA Change: K103E

DomainStartEndE-ValueType
low complexity region 18 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
B41 81 277 4.09e-69 SMART
FERM_C 281 373 1.76e-35 SMART
FA 378 422 2.86e-12 SMART
low complexity region 504 513 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149109
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.6%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G A 2: 20,849,934 T1539M possibly damaging Het
Birc3 A T 9: 7,851,051 *138R probably null Het
Bsn C A 9: 108,105,635 D3640Y unknown Het
Bsph1 A T 7: 13,450,914 M1L probably benign Het
Cdkl1 A T 12: 69,756,564 Y179* probably null Het
Cfap74 G A 4: 155,418,696 probably null Het
Crtc1 A T 8: 70,391,255 S454T probably damaging Het
Cspg5 A T 9: 110,246,526 D110V probably damaging Het
Cyp2w1 A T 5: 139,356,439 Y380F probably benign Het
Dbn1 T C 13: 55,474,227 probably benign Het
Eps8 C T 6: 137,514,307 V358I probably benign Het
Gm12253 G T 11: 58,440,020 probably benign Het
Hltf T A 3: 20,108,869 probably null Het
Hsd17b11 C T 5: 104,009,878 V123I probably benign Het
Il31ra T A 13: 112,531,673 E481V probably damaging Het
Impdh2 A G 9: 108,561,097 probably benign Het
Itih5 G A 2: 10,249,188 R750Q probably benign Het
Kndc1 A C 7: 139,923,735 K985T possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lgsn A T 1: 31,203,743 Y302F probably damaging Het
Lrp1b A G 2: 41,284,185 S1541P probably damaging Het
Mast4 A G 13: 102,770,784 M528T probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Ndufs2 T C 1: 171,236,353 probably null Het
Nwd1 G A 8: 72,709,449 V1436M probably damaging Het
Phf12 C T 11: 78,009,404 R109* probably null Het
Pml A G 9: 58,249,539 probably null Het
Ppfia2 T C 10: 106,819,511 I313T probably benign Het
Prdm14 C T 1: 13,125,438 G133D probably benign Het
Pygl A G 12: 70,211,017 probably benign Het
Rassf10 C T 7: 112,955,368 T392M probably damaging Het
Rpe65 T C 3: 159,601,583 S54P possibly damaging Het
Sema5b T C 16: 35,622,631 V2A probably benign Het
Sgsm3 T C 15: 81,011,345 I699T probably damaging Het
Spn T C 7: 127,136,331 T335A probably damaging Het
Tecta T C 9: 42,338,994 D1834G probably damaging Het
Trp53bp1 C A 2: 121,204,318 probably benign Het
Ttc3 A T 16: 94,456,789 K1652* probably null Het
Zadh2 A G 18: 84,095,207 H336R probably benign Het
Other mutations in Epb41l4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Epb41l4b APN 4 57103422 critical splice donor site probably null
IGL02311:Epb41l4b APN 4 57076456 missense probably damaging 1.00
episode UTSW 4 57142866 missense probably benign 0.00
R0456:Epb41l4b UTSW 4 57142843 splice site probably null
R0799:Epb41l4b UTSW 4 57086003 missense probably damaging 1.00
R1208:Epb41l4b UTSW 4 57077252 critical splice acceptor site probably null
R1208:Epb41l4b UTSW 4 57077252 critical splice acceptor site probably null
R1506:Epb41l4b UTSW 4 57088824 missense probably damaging 1.00
R1618:Epb41l4b UTSW 4 57032204 missense probably benign 0.00
R1919:Epb41l4b UTSW 4 57040993 missense probably damaging 0.99
R1956:Epb41l4b UTSW 4 57038553 missense possibly damaging 0.94
R2041:Epb41l4b UTSW 4 57084070 missense probably damaging 0.98
R2048:Epb41l4b UTSW 4 57142866 missense probably benign 0.00
R3434:Epb41l4b UTSW 4 57040865 missense probably benign 0.41
R4059:Epb41l4b UTSW 4 57024337 critical splice donor site probably null
R4175:Epb41l4b UTSW 4 57076556 missense probably damaging 1.00
R4694:Epb41l4b UTSW 4 57019875 missense probably benign 0.01
R4817:Epb41l4b UTSW 4 57103428 missense probably damaging 1.00
R5076:Epb41l4b UTSW 4 57040984 missense probably damaging 1.00
R5179:Epb41l4b UTSW 4 57063181 missense probably benign 0.01
R5246:Epb41l4b UTSW 4 57040989 missense probably damaging 0.99
R5530:Epb41l4b UTSW 4 57086003 missense probably damaging 1.00
R5579:Epb41l4b UTSW 4 57064802 missense possibly damaging 0.62
R5784:Epb41l4b UTSW 4 57086003 missense probably damaging 1.00
R6772:Epb41l4b UTSW 4 57063140 missense probably benign
R6965:Epb41l4b UTSW 4 57040915 missense probably damaging 1.00
R7045:Epb41l4b UTSW 4 57103522 missense possibly damaging 0.94
R7316:Epb41l4b UTSW 4 57019867 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCATTTGGGCACCACCAGCATC -3'
(R):5'- ATTCATGCTCCGTCTACGGACCAC -3'

Sequencing Primer
(F):5'- CAATTGCCAAGCTCATTACTGG -3'
(R):5'- tcagaaatccgcctgcc -3'
Posted On2013-11-08