Incidental Mutation 'R0905:Impdh2'
ID83295
Institutional Source Beutler Lab
Gene Symbol Impdh2
Ensembl Gene ENSMUSG00000062867
Gene Nameinosine monophosphate dehydrogenase 2
SynonymsIMP dehydrogenase type II
MMRRC Submission 039063-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0905 (G1)
Quality Score81
Status Validated
Chromosome9
Chromosomal Location108560286-108565584 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 108561097 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006851] [ENSMUST00000074208] [ENSMUST00000081111] [ENSMUST00000112155] [ENSMUST00000193421] [ENSMUST00000194381] [ENSMUST00000194904]
Predicted Effect probably benign
Transcript: ENSMUST00000006851
SMART Domains Protein: ENSMUSP00000006851
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Pfam:DUF3504 597 761 1.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074208
SMART Domains Protein: ENSMUSP00000073832
Gene: ENSMUSG00000070283

DomainStartEndE-ValueType
Pfam:DUF498 61 169 9.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081111
SMART Domains Protein: ENSMUSP00000079888
Gene: ENSMUSG00000062867

DomainStartEndE-ValueType
IMPDH 28 504 7.39e-260 SMART
CBS 117 168 9.4e-7 SMART
CBS 184 232 1.57e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112155
SMART Domains Protein: ENSMUSP00000107782
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Pfam:DUF3504 600 760 2.3e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193242
Predicted Effect probably benign
Transcript: ENSMUST00000193421
SMART Domains Protein: ENSMUSP00000142117
Gene: ENSMUSG00000062867

DomainStartEndE-ValueType
IMPDH 28 248 1.3e-18 SMART
CBS 92 143 4.5e-9 SMART
CBS 159 207 7.6e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194365
Predicted Effect probably benign
Transcript: ENSMUST00000194381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194689
Predicted Effect probably benign
Transcript: ENSMUST00000194904
SMART Domains Protein: ENSMUSP00000142305
Gene: ENSMUSG00000062867

DomainStartEndE-ValueType
IMPDH 1 319 5e-122 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195456
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.6%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities resulting in embryonic lethality around the time of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G A 2: 20,849,934 T1539M possibly damaging Het
Birc3 A T 9: 7,851,051 *138R probably null Het
Bsn C A 9: 108,105,635 D3640Y unknown Het
Bsph1 A T 7: 13,450,914 M1L probably benign Het
Cdkl1 A T 12: 69,756,564 Y179* probably null Het
Cfap74 G A 4: 155,418,696 probably null Het
Crtc1 A T 8: 70,391,255 S454T probably damaging Het
Cspg5 A T 9: 110,246,526 D110V probably damaging Het
Cyp2w1 A T 5: 139,356,439 Y380F probably benign Het
Dbn1 T C 13: 55,474,227 probably benign Het
Epb41l4b T C 4: 57,103,528 K103E probably damaging Het
Eps8 C T 6: 137,514,307 V358I probably benign Het
Gm12253 G T 11: 58,440,020 probably benign Het
Hltf T A 3: 20,108,869 probably null Het
Hsd17b11 C T 5: 104,009,878 V123I probably benign Het
Il31ra T A 13: 112,531,673 E481V probably damaging Het
Itih5 G A 2: 10,249,188 R750Q probably benign Het
Kndc1 A C 7: 139,923,735 K985T possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lgsn A T 1: 31,203,743 Y302F probably damaging Het
Lrp1b A G 2: 41,284,185 S1541P probably damaging Het
Mast4 A G 13: 102,770,784 M528T probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Ndufs2 T C 1: 171,236,353 probably null Het
Nwd1 G A 8: 72,709,449 V1436M probably damaging Het
Phf12 C T 11: 78,009,404 R109* probably null Het
Pml A G 9: 58,249,539 probably null Het
Ppfia2 T C 10: 106,819,511 I313T probably benign Het
Prdm14 C T 1: 13,125,438 G133D probably benign Het
Pygl A G 12: 70,211,017 probably benign Het
Rassf10 C T 7: 112,955,368 T392M probably damaging Het
Rpe65 T C 3: 159,601,583 S54P possibly damaging Het
Sema5b T C 16: 35,622,631 V2A probably benign Het
Sgsm3 T C 15: 81,011,345 I699T probably damaging Het
Spn T C 7: 127,136,331 T335A probably damaging Het
Tecta T C 9: 42,338,994 D1834G probably damaging Het
Trp53bp1 C A 2: 121,204,318 probably benign Het
Ttc3 A T 16: 94,456,789 K1652* probably null Het
Zadh2 A G 18: 84,095,207 H336R probably benign Het
Other mutations in Impdh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0032:Impdh2 UTSW 9 108561661 missense probably damaging 1.00
R0523:Impdh2 UTSW 9 108561819 unclassified probably null
R0523:Impdh2 UTSW 9 108561820 missense possibly damaging 0.80
R0644:Impdh2 UTSW 9 108563637 missense possibly damaging 0.56
R0648:Impdh2 UTSW 9 108563466 missense probably benign 0.01
R1173:Impdh2 UTSW 9 108561829 missense probably benign 0.19
R1202:Impdh2 UTSW 9 108563187 missense probably damaging 1.00
R1441:Impdh2 UTSW 9 108564776 missense probably benign 0.12
R1818:Impdh2 UTSW 9 108563212 unclassified probably null
R2141:Impdh2 UTSW 9 108565347 missense possibly damaging 0.50
R2173:Impdh2 UTSW 9 108565394 splice site probably null
R2438:Impdh2 UTSW 9 108560616 missense probably benign 0.06
R4061:Impdh2 UTSW 9 108562804 missense possibly damaging 0.46
R4273:Impdh2 UTSW 9 108564956 missense probably damaging 1.00
R4847:Impdh2 UTSW 9 108564671 missense probably damaging 1.00
R4847:Impdh2 UTSW 9 108565515 missense probably benign 0.00
R5073:Impdh2 UTSW 9 108563336 critical splice donor site probably null
R5896:Impdh2 UTSW 9 108563966 missense probably benign 0.06
R6315:Impdh2 UTSW 9 108563439 missense possibly damaging 0.66
R7172:Impdh2 UTSW 9 108560610 missense probably benign 0.00
R7182:Impdh2 UTSW 9 108563208 missense possibly damaging 0.56
R7241:Impdh2 UTSW 9 108563437 missense possibly damaging 0.78
X0066:Impdh2 UTSW 9 108561787 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TGCTGGTACAACTCCCTGCTCAAG -3'
(R):5'- CCTGGTGCAGTAAGCTCACAGTAAC -3'

Sequencing Primer
(F):5'- AACTCCCTGCTCAAGAGTTTTATG -3'
(R):5'- ACAGAGTGAGTTCCAGGACA -3'
Posted On2013-11-08