Incidental Mutation 'R0905:Cdkl1'
ID83300
Institutional Source Beutler Lab
Gene Symbol Cdkl1
Ensembl Gene ENSMUSG00000020990
Gene Namecyclin-dependent kinase-like 1 (CDC2-related kinase)
Synonyms
MMRRC Submission 039063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R0905 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location69746848-69791267 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 69756564 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 179 (Y179*)
Ref Sequence ENSEMBL: ENSMUSP00000021377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021377]
Predicted Effect probably null
Transcript: ENSMUST00000021377
AA Change: Y179*
SMART Domains Protein: ENSMUSP00000021377
Gene: ENSMUSG00000020990
AA Change: Y179*

DomainStartEndE-ValueType
S_TKc 4 287 5.27e-105 SMART
Meta Mutation Damage Score 0.6276 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a large family of CDC2-related serine/threonine protein kinases. It accumulates primarily in the nucleus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G A 2: 20,849,934 T1539M possibly damaging Het
Birc3 A T 9: 7,851,051 *138R probably null Het
Bsn C A 9: 108,105,635 D3640Y unknown Het
Bsph1 A T 7: 13,450,914 M1L probably benign Het
Cfap74 G A 4: 155,418,696 probably null Het
Crtc1 A T 8: 70,391,255 S454T probably damaging Het
Cspg5 A T 9: 110,246,526 D110V probably damaging Het
Cyp2w1 A T 5: 139,356,439 Y380F probably benign Het
Dbn1 T C 13: 55,474,227 probably benign Het
Epb41l4b T C 4: 57,103,528 K103E probably damaging Het
Eps8 C T 6: 137,514,307 V358I probably benign Het
Gm12253 G T 11: 58,440,020 probably benign Het
Hltf T A 3: 20,108,869 probably null Het
Hsd17b11 C T 5: 104,009,878 V123I probably benign Het
Il31ra T A 13: 112,531,673 E481V probably damaging Het
Impdh2 A G 9: 108,561,097 probably benign Het
Itih5 G A 2: 10,249,188 R750Q probably benign Het
Kndc1 A C 7: 139,923,735 K985T possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lgsn A T 1: 31,203,743 Y302F probably damaging Het
Lrp1b A G 2: 41,284,185 S1541P probably damaging Het
Mast4 A G 13: 102,770,784 M528T probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Ndufs2 T C 1: 171,236,353 probably null Het
Nwd1 G A 8: 72,709,449 V1436M probably damaging Het
Phf12 C T 11: 78,009,404 R109* probably null Het
Pml A G 9: 58,249,539 probably null Het
Ppfia2 T C 10: 106,819,511 I313T probably benign Het
Prdm14 C T 1: 13,125,438 G133D probably benign Het
Pygl A G 12: 70,211,017 probably benign Het
Rassf10 C T 7: 112,955,368 T392M probably damaging Het
Rpe65 T C 3: 159,601,583 S54P possibly damaging Het
Sema5b T C 16: 35,622,631 V2A probably benign Het
Sgsm3 T C 15: 81,011,345 I699T probably damaging Het
Spn T C 7: 127,136,331 T335A probably damaging Het
Tecta T C 9: 42,338,994 D1834G probably damaging Het
Trp53bp1 C A 2: 121,204,318 probably benign Het
Ttc3 A T 16: 94,456,789 K1652* probably null Het
Zadh2 A G 18: 84,095,207 H336R probably benign Het
Other mutations in Cdkl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01735:Cdkl1 APN 12 69750740 missense probably benign
IGL01859:Cdkl1 APN 12 69760129 missense probably damaging 1.00
R0218:Cdkl1 UTSW 12 69790035 missense probably benign 0.01
R3922:Cdkl1 UTSW 12 69756599 missense probably damaging 1.00
R3924:Cdkl1 UTSW 12 69756599 missense probably damaging 1.00
R3925:Cdkl1 UTSW 12 69756599 missense probably damaging 1.00
R5050:Cdkl1 UTSW 12 69757240 missense probably damaging 1.00
R5851:Cdkl1 UTSW 12 69756564 nonsense probably null
R7183:Cdkl1 UTSW 12 69748932 missense probably damaging 1.00
R7271:Cdkl1 UTSW 12 69748811 missense probably benign 0.10
R7461:Cdkl1 UTSW 12 69756461 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- AGCAGGTTCTCTCAAAGTCAGCGG -3'
(R):5'- GTGAGTACCCACGGCTTCTTCAATG -3'

Sequencing Primer
(F):5'- TCTCTCAAAGTCAGCGGAAACC -3'
(R):5'- ggaggaagcccaagtatcag -3'
Posted On2013-11-08