Incidental Mutation 'R0907:Sprr3'
ID83348
Institutional Source Beutler Lab
Gene Symbol Sprr3
Ensembl Gene ENSMUSG00000045539
Gene Namesmall proline-rich protein 3
SynonymsSPR3
MMRRC Submission 039065-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0907 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location92456502-92458720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92457009 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 176 (I176N)
Ref Sequence ENSEMBL: ENSMUSP00000056287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058142]
Predicted Effect probably benign
Transcript: ENSMUST00000058142
AA Change: I176N

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000056287
Gene: ENSMUSG00000045539
AA Change: I176N

DomainStartEndE-ValueType
Pfam:Cornifin 17 142 1.3e-35 PFAM
Pfam:Cornifin 125 236 3.9e-26 PFAM
Meta Mutation Damage Score 0.1644 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 G A 1: 156,629,859 V225M probably damaging Het
Afmid T A 11: 117,835,590 probably benign Het
Ccdc191 G A 16: 43,915,538 V216I probably benign Het
Cep112 C A 11: 108,570,432 probably benign Het
Dcbld1 T C 10: 52,261,814 V58A possibly damaging Het
Dopey2 A T 16: 93,801,593 H1882L probably damaging Het
Fat1 A G 8: 45,026,598 I2894V probably benign Het
Focad T C 4: 88,278,261 probably null Het
Gm45713 G A 7: 45,132,364 T203M possibly damaging Het
Gstm1 T C 3: 108,017,380 Y28C probably damaging Het
Gucy1a1 T C 3: 82,111,191 D113G probably benign Het
Hat1 G T 2: 71,420,617 E170* probably null Het
Herc1 C A 9: 66,433,428 F1686L possibly damaging Het
Iffo1 A G 6: 125,153,161 E270G probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrp3 A T 7: 35,203,293 Y522N probably damaging Het
Lrp6 A T 6: 134,507,525 D378E probably damaging Het
Mmrn1 A G 6: 60,973,119 N351S probably benign Het
Olfr1 A T 11: 73,395,119 L301Q probably damaging Het
Olfr1500 T C 19: 13,827,856 D180G probably damaging Het
Pcnx3 T C 19: 5,671,525 K1082E possibly damaging Het
Pikfyve T C 1: 65,202,830 V243A possibly damaging Het
Qdpr G C 5: 45,439,386 I145M probably benign Het
Rasgrp3 G T 17: 75,509,827 probably null Het
Rd3l G T 12: 111,980,140 Y1* probably null Het
Sf3b3 A G 8: 110,811,510 probably benign Het
Smn1 C T 13: 100,127,896 T45I probably damaging Het
Sv2c T C 13: 96,088,255 D182G probably damaging Het
Tnni3k A T 3: 154,941,679 V397D probably damaging Het
Trpt1 G T 19: 6,998,940 G235V possibly damaging Het
Ttll10 A T 4: 156,036,164 C367* probably null Het
Unc5c A G 3: 141,789,033 Q369R probably damaging Het
Other mutations in Sprr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02557:Sprr3 APN 3 92457166 missense possibly damaging 0.95
R0070:Sprr3 UTSW 3 92457302 missense probably benign
R0512:Sprr3 UTSW 3 92457477 missense possibly damaging 0.71
R1976:Sprr3 UTSW 3 92456946 missense possibly damaging 0.52
R4241:Sprr3 UTSW 3 92456907 missense possibly damaging 0.92
R4503:Sprr3 UTSW 3 92457376 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TTACAGGAAAGACTTCAGCAGCAGG -3'
(R):5'- TGGGCCATGCTCTACCAACATCAC -3'

Sequencing Primer
(F):5'- TTCAGCAGCAGGTGGTCAG -3'
(R):5'- ACAATTCCTGGGCCATGC -3'
Posted On2013-11-08