Incidental Mutation 'R0907:Ttll10'
ID83353
Institutional Source Beutler Lab
Gene Symbol Ttll10
Ensembl Gene ENSMUSG00000029074
Gene Nametubulin tyrosine ligase-like family, member 10
Synonyms4930595O22Rik, Ttll5, 4833412E22Rik
MMRRC Submission 039065-MU
Accession Numbers

Genbank: NM_029264; MGI: 1921855

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0907 (G1)
Quality Score221
Status Validated
Chromosome4
Chromosomal Location156034840-156059414 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 156036164 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 367 (C367*)
Ref Sequence ENSEMBL: ENSMUSP00000139077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051509] [ENSMUST00000184348] [ENSMUST00000184684]
Predicted Effect probably null
Transcript: ENSMUST00000051509
AA Change: C456*
SMART Domains Protein: ENSMUSP00000055671
Gene: ENSMUSG00000029074
AA Change: C456*

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 63 73 N/A INTRINSIC
low complexity region 104 118 N/A INTRINSIC
Pfam:TTL 189 507 1.8e-48 PFAM
low complexity region 541 583 N/A INTRINSIC
low complexity region 587 600 N/A INTRINSIC
low complexity region 622 638 N/A INTRINSIC
low complexity region 652 671 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151836
Predicted Effect probably null
Transcript: ENSMUST00000184348
AA Change: C485*
SMART Domains Protein: ENSMUSP00000139316
Gene: ENSMUSG00000029074
AA Change: C485*

DomainStartEndE-ValueType
low complexity region 92 102 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Pfam:TTL 218 536 7.9e-48 PFAM
low complexity region 570 612 N/A INTRINSIC
low complexity region 616 629 N/A INTRINSIC
low complexity region 651 667 N/A INTRINSIC
low complexity region 681 700 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184684
AA Change: C367*
SMART Domains Protein: ENSMUSP00000139077
Gene: ENSMUSG00000029074
AA Change: C367*

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
Pfam:TTL 100 418 2.5e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184750
Meta Mutation Damage Score 0.692 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 G A 1: 156,629,859 V225M probably damaging Het
Afmid T A 11: 117,835,590 probably benign Het
Ccdc191 G A 16: 43,915,538 V216I probably benign Het
Cep112 C A 11: 108,570,432 probably benign Het
Dcbld1 T C 10: 52,261,814 V58A possibly damaging Het
Dopey2 A T 16: 93,801,593 H1882L probably damaging Het
Fat1 A G 8: 45,026,598 I2894V probably benign Het
Focad T C 4: 88,278,261 probably null Het
Gm45713 G A 7: 45,132,364 T203M possibly damaging Het
Gstm1 T C 3: 108,017,380 Y28C probably damaging Het
Gucy1a1 T C 3: 82,111,191 D113G probably benign Het
Hat1 G T 2: 71,420,617 E170* probably null Het
Herc1 C A 9: 66,433,428 F1686L possibly damaging Het
Iffo1 A G 6: 125,153,161 E270G probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrp3 A T 7: 35,203,293 Y522N probably damaging Het
Lrp6 A T 6: 134,507,525 D378E probably damaging Het
Mmrn1 A G 6: 60,973,119 N351S probably benign Het
Olfr1 A T 11: 73,395,119 L301Q probably damaging Het
Olfr1500 T C 19: 13,827,856 D180G probably damaging Het
Pcnx3 T C 19: 5,671,525 K1082E possibly damaging Het
Pikfyve T C 1: 65,202,830 V243A possibly damaging Het
Qdpr G C 5: 45,439,386 I145M probably benign Het
Rasgrp3 G T 17: 75,509,827 probably null Het
Rd3l G T 12: 111,980,140 Y1* probably null Het
Sf3b3 A G 8: 110,811,510 probably benign Het
Smn1 C T 13: 100,127,896 T45I probably damaging Het
Sprr3 A T 3: 92,457,009 I176N probably benign Het
Sv2c T C 13: 96,088,255 D182G probably damaging Het
Tnni3k A T 3: 154,941,679 V397D probably damaging Het
Trpt1 G T 19: 6,998,940 G235V possibly damaging Het
Unc5c A G 3: 141,789,033 Q369R probably damaging Het
Other mutations in Ttll10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Ttll10 APN 4 156046894 missense probably benign 0.09
IGL02109:Ttll10 APN 4 156047480 missense probably benign
IGL02121:Ttll10 APN 4 156048433 missense probably benign 0.04
F6893:Ttll10 UTSW 4 156048318 missense probably benign 0.00
R0366:Ttll10 UTSW 4 156035155 missense probably damaging 0.97
R0502:Ttll10 UTSW 4 156047548 splice site probably benign
R0503:Ttll10 UTSW 4 156047548 splice site probably benign
R0523:Ttll10 UTSW 4 156045361 nonsense probably null
R0865:Ttll10 UTSW 4 156043678 missense probably damaging 1.00
R1125:Ttll10 UTSW 4 156035038 missense possibly damaging 0.73
R1555:Ttll10 UTSW 4 156035139 missense probably benign 0.00
R1797:Ttll10 UTSW 4 156047567 missense probably damaging 0.96
R3899:Ttll10 UTSW 4 156035800 missense probably damaging 1.00
R4426:Ttll10 UTSW 4 156048561 missense possibly damaging 0.55
R5715:Ttll10 UTSW 4 156045391 missense probably damaging 1.00
R5762:Ttll10 UTSW 4 156034981 missense possibly damaging 0.93
R5814:Ttll10 UTSW 4 156047627 missense possibly damaging 0.51
R5958:Ttll10 UTSW 4 156036066 intron probably null
R5994:Ttll10 UTSW 4 156048732 intron probably null
R6084:Ttll10 UTSW 4 156045357 missense probably benign 0.34
R7027:Ttll10 UTSW 4 156035801 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CCCAGTGATTCCGGGCAGATTAATG -3'
(R):5'- ACAGGTGTGACTGATTGTTCAGGC -3'

Sequencing Primer
(F):5'- CCTTGTTTGCTCAAGGAGTTAAGAC -3'
(R):5'- AGATCATGTCCCACTGCTTC -3'
Posted On2013-11-08