Incidental Mutation 'R0907:Lrp3'
ID83358
Institutional Source Beutler Lab
Gene Symbol Lrp3
Ensembl Gene ENSMUSG00000001802
Gene Namelow density lipoprotein receptor-related protein 3
Synonyms
MMRRC Submission 039065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R0907 (G1)
Quality Score221
Status Validated
Chromosome7
Chromosomal Location35200027-35215498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35203293 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 522 (Y522N)
Ref Sequence ENSEMBL: ENSMUSP00000113406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001854] [ENSMUST00000118444] [ENSMUST00000122409] [ENSMUST00000131048]
Predicted Effect probably benign
Transcript: ENSMUST00000001854
SMART Domains Protein: ENSMUSP00000001854
Gene: ENSMUSG00000030495

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Pfam:AA_permease_2 46 474 4.8e-65 PFAM
Pfam:AA_permease 51 467 9.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118444
AA Change: Y522N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113406
Gene: ENSMUSG00000001802
AA Change: Y522N

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
CUB 43 159 9.97e-20 SMART
LDLa 165 202 7.21e-11 SMART
LDLa 211 251 1.37e-11 SMART
CUB 254 365 1.98e-3 SMART
LDLa 367 414 1.85e-1 SMART
LDLa 415 453 4.44e-3 SMART
LDLa 454 490 8.74e-10 SMART
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 584 606 N/A INTRINSIC
low complexity region 641 652 N/A INTRINSIC
low complexity region 674 684 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122409
AA Change: Y543N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114026
Gene: ENSMUSG00000001802
AA Change: Y543N

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
CUB 64 180 9.97e-20 SMART
LDLa 186 223 7.21e-11 SMART
LDLa 232 272 1.37e-11 SMART
CUB 275 386 1.98e-3 SMART
LDLa 388 435 1.85e-1 SMART
LDLa 436 474 4.44e-3 SMART
LDLa 475 511 8.74e-10 SMART
transmembrane domain 518 540 N/A INTRINSIC
low complexity region 605 627 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131048
SMART Domains Protein: ENSMUSP00000118331
Gene: ENSMUSG00000030495

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Pfam:AA_permease_2 46 346 8.6e-48 PFAM
Pfam:AA_permease 51 346 1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155404
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 G A 1: 156,629,859 V225M probably damaging Het
Afmid T A 11: 117,835,590 probably benign Het
Ccdc191 G A 16: 43,915,538 V216I probably benign Het
Cep112 C A 11: 108,570,432 probably benign Het
Dcbld1 T C 10: 52,261,814 V58A possibly damaging Het
Dopey2 A T 16: 93,801,593 H1882L probably damaging Het
Fat1 A G 8: 45,026,598 I2894V probably benign Het
Focad T C 4: 88,278,261 probably null Het
Gm45713 G A 7: 45,132,364 T203M possibly damaging Het
Gstm1 T C 3: 108,017,380 Y28C probably damaging Het
Gucy1a1 T C 3: 82,111,191 D113G probably benign Het
Hat1 G T 2: 71,420,617 E170* probably null Het
Herc1 C A 9: 66,433,428 F1686L possibly damaging Het
Iffo1 A G 6: 125,153,161 E270G probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrp6 A T 6: 134,507,525 D378E probably damaging Het
Mmrn1 A G 6: 60,973,119 N351S probably benign Het
Olfr1 A T 11: 73,395,119 L301Q probably damaging Het
Olfr1500 T C 19: 13,827,856 D180G probably damaging Het
Pcnx3 T C 19: 5,671,525 K1082E possibly damaging Het
Pikfyve T C 1: 65,202,830 V243A possibly damaging Het
Qdpr G C 5: 45,439,386 I145M probably benign Het
Rasgrp3 G T 17: 75,509,827 probably null Het
Rd3l G T 12: 111,980,140 Y1* probably null Het
Sf3b3 A G 8: 110,811,510 probably benign Het
Smn1 C T 13: 100,127,896 T45I probably damaging Het
Sprr3 A T 3: 92,457,009 I176N probably benign Het
Sv2c T C 13: 96,088,255 D182G probably damaging Het
Tnni3k A T 3: 154,941,679 V397D probably damaging Het
Trpt1 G T 19: 6,998,940 G235V possibly damaging Het
Ttll10 A T 4: 156,036,164 C367* probably null Het
Unc5c A G 3: 141,789,033 Q369R probably damaging Het
Other mutations in Lrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Lrp3 APN 7 35206028 splice site probably benign
IGL01714:Lrp3 APN 7 35206071 unclassified probably null
IGL03033:Lrp3 APN 7 35202627 missense possibly damaging 0.61
IGL03166:Lrp3 APN 7 35202480 missense probably benign 0.00
PIT4434001:Lrp3 UTSW 7 35203995 missense probably damaging 0.99
R0416:Lrp3 UTSW 7 35202353 missense probably benign
R0733:Lrp3 UTSW 7 35202120 missense possibly damaging 0.93
R1437:Lrp3 UTSW 7 35213170 missense probably damaging 1.00
R1591:Lrp3 UTSW 7 35202365 missense probably benign 0.03
R1625:Lrp3 UTSW 7 35203925 missense probably damaging 1.00
R1703:Lrp3 UTSW 7 35213161 missense possibly damaging 0.95
R3976:Lrp3 UTSW 7 35204105 missense probably benign 0.06
R4196:Lrp3 UTSW 7 35203410 missense probably damaging 1.00
R4679:Lrp3 UTSW 7 35203940 missense probably damaging 1.00
R5686:Lrp3 UTSW 7 35203485 missense possibly damaging 0.84
R5836:Lrp3 UTSW 7 35203322 missense probably damaging 1.00
R6160:Lrp3 UTSW 7 35204123 missense possibly damaging 0.79
R6342:Lrp3 UTSW 7 35202306 missense probably benign 0.01
R6364:Lrp3 UTSW 7 35203709 missense probably benign 0.03
R6415:Lrp3 UTSW 7 35204168 missense probably benign 0.00
R6502:Lrp3 UTSW 7 35203988 missense possibly damaging 0.89
R6747:Lrp3 UTSW 7 35211437 missense probably benign
R7205:Lrp3 UTSW 7 35202626 missense probably damaging 0.99
R7232:Lrp3 UTSW 7 35206052 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAACTCTGCCTCTAAGCGTGTC -3'
(R):5'- AGAACTGCTTTTCCTGCCAGCC -3'

Sequencing Primer
(F):5'- GCCTCTAAGCGTGTCATTTG -3'
(R):5'- TGGTACGAACCTGTGCATC -3'
Posted On2013-11-08