Incidental Mutation 'R0907:Rd3l'
ID83367
Institutional Source Beutler Lab
Gene Symbol Rd3l
Ensembl Gene ENSMUSG00000091402
Gene Nameretinal degeneration 3-like
Synonyms
MMRRC Submission 039065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R0907 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111979111-111981317 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 111980140 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1 (Y1*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079009] [ENSMUST00000170525] [ENSMUST00000185354] [ENSMUST00000189759] [ENSMUST00000190536]
Predicted Effect probably benign
Transcript: ENSMUST00000079009
SMART Domains Protein: ENSMUSP00000078022
Gene: ENSMUSG00000054003

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
DEXDc 132 327 5.64e-21 SMART
HELICc 404 502 3.22e-16 SMART
low complexity region 547 561 N/A INTRINSIC
HA2 565 666 1.9e-20 SMART
TUDOR 944 1003 1.52e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170525
AA Change: Y67*
SMART Domains Protein: ENSMUSP00000130014
Gene: ENSMUSG00000091402
AA Change: Y67*

DomainStartEndE-ValueType
Pfam:RD3 5 133 5.3e-54 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000185354
AA Change: Y67*
SMART Domains Protein: ENSMUSP00000140987
Gene: ENSMUSG00000091402
AA Change: Y67*

DomainStartEndE-ValueType
Pfam:RD3 4 100 2.9e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000189759
AA Change: Y67*
SMART Domains Protein: ENSMUSP00000140454
Gene: ENSMUSG00000091402
AA Change: Y67*

DomainStartEndE-ValueType
Pfam:RD3 4 135 2.4e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000190536
AA Change: Y67*
SMART Domains Protein: ENSMUSP00000140410
Gene: ENSMUSG00000091402
AA Change: Y67*

DomainStartEndE-ValueType
Pfam:RD3 4 135 2.4e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000190680
AA Change: Y1*
Meta Mutation Damage Score 0.622 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (34/34)
MGI Phenotype Male homozygous mice are sterile, displaying small testis, arrest of male meiosis and abnormal spermatocyte morphology. Females are fertile.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 G A 1: 156,629,859 V225M probably damaging Het
Afmid T A 11: 117,835,590 probably benign Het
Ccdc191 G A 16: 43,915,538 V216I probably benign Het
Cep112 C A 11: 108,570,432 probably benign Het
Dcbld1 T C 10: 52,261,814 V58A possibly damaging Het
Dopey2 A T 16: 93,801,593 H1882L probably damaging Het
Fat1 A G 8: 45,026,598 I2894V probably benign Het
Focad T C 4: 88,278,261 probably null Het
Gm45713 G A 7: 45,132,364 T203M possibly damaging Het
Gstm1 T C 3: 108,017,380 Y28C probably damaging Het
Gucy1a1 T C 3: 82,111,191 D113G probably benign Het
Hat1 G T 2: 71,420,617 E170* probably null Het
Herc1 C A 9: 66,433,428 F1686L possibly damaging Het
Iffo1 A G 6: 125,153,161 E270G probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrp3 A T 7: 35,203,293 Y522N probably damaging Het
Lrp6 A T 6: 134,507,525 D378E probably damaging Het
Mmrn1 A G 6: 60,973,119 N351S probably benign Het
Olfr1 A T 11: 73,395,119 L301Q probably damaging Het
Olfr1500 T C 19: 13,827,856 D180G probably damaging Het
Pcnx3 T C 19: 5,671,525 K1082E possibly damaging Het
Pikfyve T C 1: 65,202,830 V243A possibly damaging Het
Qdpr G C 5: 45,439,386 I145M probably benign Het
Rasgrp3 G T 17: 75,509,827 probably null Het
Sf3b3 A G 8: 110,811,510 probably benign Het
Smn1 C T 13: 100,127,896 T45I probably damaging Het
Sprr3 A T 3: 92,457,009 I176N probably benign Het
Sv2c T C 13: 96,088,255 D182G probably damaging Het
Tnni3k A T 3: 154,941,679 V397D probably damaging Het
Trpt1 G T 19: 6,998,940 G235V possibly damaging Het
Ttll10 A T 4: 156,036,164 C367* probably null Het
Unc5c A G 3: 141,789,033 Q369R probably damaging Het
Other mutations in Rd3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02186:Rd3l APN 12 111979467 missense probably benign 0.04
IGL02928:Rd3l APN 12 111979578 missense probably benign 0.01
R0675:Rd3l UTSW 12 111980162 missense probably benign 0.34
R1127:Rd3l UTSW 12 111980283 missense probably benign 0.00
R4066:Rd3l UTSW 12 111979511 missense probably benign 0.35
R4067:Rd3l UTSW 12 111979511 missense probably benign 0.35
R4439:Rd3l UTSW 12 111979658 missense possibly damaging 0.95
R4959:Rd3l UTSW 12 111980144 unclassified probably null
Predicted Primers PCR Primer
(F):5'- AGGCAGCTTTTAGTCTGAATCTCACAC -3'
(R):5'- GGACAGCACTTTTCAAGTTGGTGATG -3'

Sequencing Primer
(F):5'- TTTAGTCTGAATCTCACACACCAC -3'
(R):5'- GACCTGCATGTTTTACCAGTG -3'
Posted On2013-11-08