Incidental Mutation 'R0908:Olfr937'
ID83394
Institutional Source Beutler Lab
Gene Symbol Olfr937
Ensembl Gene ENSMUSG00000094182
Gene Nameolfactory receptor 937
SynonymsMOR171-24, GA_x6K02T2PVTD-32756567-32755632
MMRRC Submission 039066-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R0908 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39059729-39060664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39059947 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 240 (T240A)
Ref Sequence ENSEMBL: ENSMUSP00000058346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055567] [ENSMUST00000215049]
Predicted Effect probably damaging
Transcript: ENSMUST00000055567
AA Change: T240A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058346
Gene: ENSMUSG00000094182
AA Change: T240A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.8e-49 PFAM
Pfam:7tm_1 41 290 1.7e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215049
AA Change: T240A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,070,077 F1676I probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atp8b3 T C 10: 80,520,084 T1265A probably benign Het
Cep112 T C 11: 108,664,497 V679A possibly damaging Het
Cts8 A T 13: 61,250,916 Y259N probably damaging Het
Depdc7 A G 2: 104,728,092 S195P probably benign Het
Dio2 A T 12: 90,729,648 C189S probably damaging Het
Dmc1 A G 15: 79,585,689 L189P probably damaging Het
Ehmt1 A G 2: 24,804,888 Y1016H probably damaging Het
Gle1 T C 2: 29,936,121 S71P probably benign Het
Gykl1 T A 18: 52,695,369 *550K probably null Het
Klhl32 T C 4: 24,682,092 D197G probably damaging Het
Krt78 G A 15: 101,950,901 T287M probably damaging Het
Lgr6 C T 1: 134,994,010 A476T probably damaging Het
Mrpl1 A T 5: 96,262,083 I272L probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Olfr596 T C 7: 103,310,573 V284A possibly damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Pde5a A T 3: 122,779,001 I344L probably benign Het
Prl7c1 A G 13: 27,773,734 I241T possibly damaging Het
Rp1 T C 1: 4,344,655 E2078G probably benign Het
Scamp3 T C 3: 89,179,439 probably null Het
Sept8 A G 11: 53,537,870 H414R probably benign Het
Spata5 T A 3: 37,431,623 probably null Het
Spef2 T A 15: 9,614,195 probably null Het
Txlnb A G 10: 17,799,177 N26S probably damaging Het
Vmn1r11 G T 6: 57,138,064 V238L probably damaging Het
Other mutations in Olfr937
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Olfr937 APN 9 39059863 missense probably benign 0.03
IGL01387:Olfr937 APN 9 39060321 missense probably damaging 1.00
IGL01775:Olfr937 APN 9 39060467 missense probably damaging 1.00
IGL02076:Olfr937 APN 9 39060585 missense probably damaging 1.00
IGL02740:Olfr937 APN 9 39060289 missense probably benign 0.22
IGL03115:Olfr937 APN 9 39059963 missense probably damaging 0.99
R0121:Olfr937 UTSW 9 39059760 missense probably damaging 1.00
R1559:Olfr937 UTSW 9 39060141 missense probably benign 0.20
R2006:Olfr937 UTSW 9 39060433 missense probably damaging 0.99
R2010:Olfr937 UTSW 9 39060099 missense probably benign 0.05
R2191:Olfr937 UTSW 9 39060405 missense probably benign
R3874:Olfr937 UTSW 9 39060174 missense probably benign 0.00
R4970:Olfr937 UTSW 9 39060531 missense probably benign 0.12
R5217:Olfr937 UTSW 9 39059769 missense probably benign 0.00
R5836:Olfr937 UTSW 9 39060622 missense probably benign
R5886:Olfr937 UTSW 9 39060382 missense probably benign 0.00
R6109:Olfr937 UTSW 9 39060196 missense probably benign 0.23
X0022:Olfr937 UTSW 9 39060417 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TTCTTCAGGGCAACACTGACATCC -3'
(R):5'- TGCATCAGCTCACACAGGCTTC -3'

Sequencing Primer
(F):5'- GGGCAACACTGACATCCTTATTC -3'
(R):5'- GAGGTGATCAACCACTATTTCTGTG -3'
Posted OnNov 08, 2013