Incidental Mutation 'R0908:Atp8b3'
ID83397
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene NameATPase, class I, type 8B, member 3
Synonyms1700042F02Rik, SAPLT, 1700056N23Rik
MMRRC Submission 039066-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R0908 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80519585-80539124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80520084 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1265 (T1265A)
Ref Sequence ENSEMBL: ENSMUSP00000020383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383]
Predicted Effect probably benign
Transcript: ENSMUST00000020383
AA Change: T1265A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: T1265A

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,070,077 F1676I probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Cep112 T C 11: 108,664,497 V679A possibly damaging Het
Cts8 A T 13: 61,250,916 Y259N probably damaging Het
Depdc7 A G 2: 104,728,092 S195P probably benign Het
Dio2 A T 12: 90,729,648 C189S probably damaging Het
Dmc1 A G 15: 79,585,689 L189P probably damaging Het
Ehmt1 A G 2: 24,804,888 Y1016H probably damaging Het
Gle1 T C 2: 29,936,121 S71P probably benign Het
Gykl1 T A 18: 52,695,369 *550K probably null Het
Klhl32 T C 4: 24,682,092 D197G probably damaging Het
Krt78 G A 15: 101,950,901 T287M probably damaging Het
Lgr6 C T 1: 134,994,010 A476T probably damaging Het
Mrpl1 A T 5: 96,262,083 I272L probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Olfr596 T C 7: 103,310,573 V284A possibly damaging Het
Olfr937 T C 9: 39,059,947 T240A probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Pde5a A T 3: 122,779,001 I344L probably benign Het
Prl7c1 A G 13: 27,773,734 I241T possibly damaging Het
Rp1 T C 1: 4,344,655 E2078G probably benign Het
Scamp3 T C 3: 89,179,439 probably null Het
Sept8 A G 11: 53,537,870 H414R probably benign Het
Spata5 T A 3: 37,431,623 probably null Het
Spef2 T A 15: 9,614,195 probably null Het
Txlnb A G 10: 17,799,177 N26S probably damaging Het
Vmn1r11 G T 6: 57,138,064 V238L probably damaging Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80530987 missense probably damaging 0.99
IGL00484:Atp8b3 APN 10 80526164 unclassified probably benign
IGL00904:Atp8b3 APN 10 80528764 missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80524376 missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80534229 unclassified probably benign
IGL01448:Atp8b3 APN 10 80520422 missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80530968 nonsense probably null
IGL01754:Atp8b3 APN 10 80530961 unclassified probably null
IGL01809:Atp8b3 APN 10 80520011 missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80521828 missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80527233 unclassified probably benign
IGL02224:Atp8b3 APN 10 80525976 unclassified probably benign
IGL02377:Atp8b3 APN 10 80520294 missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80530628 unclassified probably damaging 1.00
IGL03090:Atp8b3 APN 10 80530604 missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80534458 missense possibly damaging 0.82
R0277:Atp8b3 UTSW 10 80526909 missense probably benign 0.21
R0973:Atp8b3 UTSW 10 80534198 missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80531018 missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80520183 missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80532542 missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80525785 missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80532578 missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80521801 missense probably damaging 1.00
R1717:Atp8b3 UTSW 10 80528797 missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80530078 missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80525386 missense probably null
R2138:Atp8b3 UTSW 10 80527105 missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80530988 missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80526894 missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80534183 missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80519912 missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80526180 missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80529706 missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80523847 missense probably benign
R4518:Atp8b3 UTSW 10 80523847 missense probably benign
R4519:Atp8b3 UTSW 10 80523847 missense probably benign
R4619:Atp8b3 UTSW 10 80526024 missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80525623 missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80536770 missense probably damaging 0.99
R4774:Atp8b3 UTSW 10 80536322 missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80524354 missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80521842 missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80529699 missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80520173 missense probably benign
R5990:Atp8b3 UTSW 10 80525697 missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80529681 missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80520323 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACTGTTGCATTGTCCTGGATGACTG -3'
(R):5'- AGTCTGTGAATCCCTGAACCCACC -3'

Sequencing Primer
(F):5'- TCCTGGATGACTGGGAATCTCC -3'
(R):5'- CCCGAAGAAGACATTCCCTTG -3'
Posted OnNov 08, 2013