Incidental Mutation 'R0908:Dio2'
ID83400
Institutional Source Beutler Lab
Gene Symbol Dio2
Ensembl Gene ENSMUSG00000007682
Gene Namedeiodinase, iodothyronine, type II
Synonyms
MMRRC Submission 039066-MU
Accession Numbers
Stock #R0908 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location90724554-90738438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90729648 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 189 (C189S)
Ref Sequence ENSEMBL: ENSMUSP00000081013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082432]
Predicted Effect probably damaging
Transcript: ENSMUST00000082432
AA Change: C189S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081013
Gene: ENSMUSG00000007682
AA Change: C189S

DomainStartEndE-ValueType
Pfam:T4_deiodinase 4 259 1.6e-119 PFAM
Pfam:AhpC-TSA 78 237 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype Mice homozygous for a disruption in this gene display elevated thyroxine (T4) and thyroid-stimulating hormone levels and changes in the metabolism and excretion of iodothyronines.
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,070,077 F1676I probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atp8b3 T C 10: 80,520,084 T1265A probably benign Het
Cep112 T C 11: 108,664,497 V679A possibly damaging Het
Cts8 A T 13: 61,250,916 Y259N probably damaging Het
Depdc7 A G 2: 104,728,092 S195P probably benign Het
Dmc1 A G 15: 79,585,689 L189P probably damaging Het
Ehmt1 A G 2: 24,804,888 Y1016H probably damaging Het
Gle1 T C 2: 29,936,121 S71P probably benign Het
Gykl1 T A 18: 52,695,369 *550K probably null Het
Klhl32 T C 4: 24,682,092 D197G probably damaging Het
Krt78 G A 15: 101,950,901 T287M probably damaging Het
Lgr6 C T 1: 134,994,010 A476T probably damaging Het
Mrpl1 A T 5: 96,262,083 I272L probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Olfr596 T C 7: 103,310,573 V284A possibly damaging Het
Olfr937 T C 9: 39,059,947 T240A probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Pde5a A T 3: 122,779,001 I344L probably benign Het
Prl7c1 A G 13: 27,773,734 I241T possibly damaging Het
Rp1 T C 1: 4,344,655 E2078G probably benign Het
Scamp3 T C 3: 89,179,439 probably null Het
Sept8 A G 11: 53,537,870 H414R probably benign Het
Spata5 T A 3: 37,431,623 probably null Het
Spef2 T A 15: 9,614,195 probably null Het
Txlnb A G 10: 17,799,177 N26S probably damaging Het
Vmn1r11 G T 6: 57,138,064 V238L probably damaging Het
Other mutations in Dio2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02665:Dio2 APN 12 90729653 missense possibly damaging 0.87
IGL02832:Dio2 APN 12 90729404 utr 3 prime 0.00
R0139:Dio2 UTSW 12 90729843 missense probably damaging 1.00
R0620:Dio2 UTSW 12 90738071 missense probably benign 0.24
R1106:Dio2 UTSW 12 90738211 missense probably damaging 1.00
R1799:Dio2 UTSW 12 90729906 missense probably benign 0.00
R2099:Dio2 UTSW 12 90729823 makesense probably null
R2101:Dio2 UTSW 12 90729823 makesense probably null
R4615:Dio2 UTSW 12 90729821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTCTTCTCCAGCCAACTTCGGAC -3'
(R):5'- TCTTGACTTTGCCAGTGCAGAGC -3'

Sequencing Primer
(F):5'- AGCCAACTTCGGACTTCTTGTAG -3'
(R):5'- GGTCAACTTTGGTTCAGCCAC -3'
Posted OnNov 08, 2013