Incidental Mutation 'R0908:Dio2'
ID83400
Institutional Source Beutler Lab
Gene Symbol Dio2
Ensembl Gene ENSMUSG00000007682
Gene Namedeiodinase, iodothyronine, type II
Synonyms
MMRRC Submission 039066-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R0908 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location90724552-90738438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90729648 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 189 (C189S)
Ref Sequence ENSEMBL: ENSMUSP00000081013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082432]
Predicted Effect probably damaging
Transcript: ENSMUST00000082432
AA Change: C189S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081013
Gene: ENSMUSG00000007682
AA Change: C189S

DomainStartEndE-ValueType
Pfam:T4_deiodinase 4 259 1.6e-119 PFAM
Pfam:AhpC-TSA 78 237 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the iodothyronine deiodinase family. It catalyzes the conversion of prohormone thyroxine (3,5,3',5'-tetraiodothyronine, T4) to the bioactive thyroid hormone (3,5,3'-triiodothyronine, T3) by outer ring 5'-deiodination. This gene is highly expressed in brain, placenta and mammary gland. It is thought to be responsible for the 'local' production of T3, and thus important in influencing thyroid hormone action in these tissues. Knockout studies in mice suggest that this gene may play an important role in brown adipose tissue lipogenesis, auditory function, and bone formation. This protein is a selenoprotein containing the rare selenocysteine (Sec) amino acid at its active site, and may contain additional Sec residues. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display elevated thyroxine (T4) and thyroid-stimulating hormone levels, changes in the metabolism and excretion of iodothyronines, and impaired adaptive thermogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,070,077 F1676I probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atp8b3 T C 10: 80,520,084 T1265A probably benign Het
Cep112 T C 11: 108,664,497 V679A possibly damaging Het
Cts8 A T 13: 61,250,916 Y259N probably damaging Het
Depdc7 A G 2: 104,728,092 S195P probably benign Het
Dmc1 A G 15: 79,585,689 L189P probably damaging Het
Ehmt1 A G 2: 24,804,888 Y1016H probably damaging Het
Gle1 T C 2: 29,936,121 S71P probably benign Het
Gykl1 T A 18: 52,695,369 *550K probably null Het
Klhl32 T C 4: 24,682,092 D197G probably damaging Het
Krt78 G A 15: 101,950,901 T287M probably damaging Het
Lgr6 C T 1: 134,994,010 A476T probably damaging Het
Mrpl1 A T 5: 96,262,083 I272L probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Olfr596 T C 7: 103,310,573 V284A possibly damaging Het
Olfr937 T C 9: 39,059,947 T240A probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Pde5a A T 3: 122,779,001 I344L probably benign Het
Prl7c1 A G 13: 27,773,734 I241T possibly damaging Het
Rp1 T C 1: 4,344,655 E2078G probably benign Het
Scamp3 T C 3: 89,179,439 probably null Het
Sept8 A G 11: 53,537,870 H414R probably benign Het
Spata5 T A 3: 37,431,623 probably null Het
Spef2 T A 15: 9,614,195 probably null Het
Txlnb A G 10: 17,799,177 N26S probably damaging Het
Vmn1r11 G T 6: 57,138,064 V201L probably damaging Het
Other mutations in Dio2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02665:Dio2 APN 12 90729653 missense possibly damaging 0.87
IGL02832:Dio2 APN 12 90729404 utr 3 prime probably benign
R0139:Dio2 UTSW 12 90729843 missense probably damaging 1.00
R0620:Dio2 UTSW 12 90738071 missense probably benign 0.24
R1106:Dio2 UTSW 12 90738211 missense probably damaging 1.00
R1799:Dio2 UTSW 12 90729906 missense probably benign 0.00
R2099:Dio2 UTSW 12 90729823 makesense probably null
R2101:Dio2 UTSW 12 90729823 makesense probably null
R4615:Dio2 UTSW 12 90729821 missense probably damaging 1.00
R6561:Dio2 UTSW 12 90729833 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATTCTTCTCCAGCCAACTTCGGAC -3'
(R):5'- TCTTGACTTTGCCAGTGCAGAGC -3'

Sequencing Primer
(F):5'- AGCCAACTTCGGACTTCTTGTAG -3'
(R):5'- GGTCAACTTTGGTTCAGCCAC -3'
Posted OnNov 08, 2013