Incidental Mutation 'R0908:Cts8'
ID83402
Institutional Source Beutler Lab
Gene Symbol Cts8
Ensembl Gene ENSMUSG00000057446
Gene Namecathepsin 8
SynonymsCTS2, Epcs68, Epcs70
MMRRC Submission 039066-MU
Accession Numbers

Genbank: NM_019541; MGI: 1860275

Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R0908 (G1)
Quality Score219
Status Not validated
Chromosome13
Chromosomal Location61246747-61255348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61250916 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 259 (Y259N)
Ref Sequence ENSEMBL: ENSMUSP00000021891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021891]
Predicted Effect probably damaging
Transcript: ENSMUST00000021891
AA Change: Y259N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021891
Gene: ENSMUSG00000057446
AA Change: Y259N

DomainStartEndE-ValueType
Inhibitor_I29 29 88 1.92e-21 SMART
Pept_C1 114 332 2.28e-112 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,070,077 F1676I probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atp8b3 T C 10: 80,520,084 T1265A probably benign Het
Cep112 T C 11: 108,664,497 V679A possibly damaging Het
Depdc7 A G 2: 104,728,092 S195P probably benign Het
Dio2 A T 12: 90,729,648 C189S probably damaging Het
Dmc1 A G 15: 79,585,689 L189P probably damaging Het
Ehmt1 A G 2: 24,804,888 Y1016H probably damaging Het
Gle1 T C 2: 29,936,121 S71P probably benign Het
Gykl1 T A 18: 52,695,369 *550K probably null Het
Klhl32 T C 4: 24,682,092 D197G probably damaging Het
Krt78 G A 15: 101,950,901 T287M probably damaging Het
Lgr6 C T 1: 134,994,010 A476T probably damaging Het
Mrpl1 A T 5: 96,262,083 I272L probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Olfr596 T C 7: 103,310,573 V284A possibly damaging Het
Olfr937 T C 9: 39,059,947 T240A probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Pde5a A T 3: 122,779,001 I344L probably benign Het
Prl7c1 A G 13: 27,773,734 I241T possibly damaging Het
Rp1 T C 1: 4,344,655 E2078G probably benign Het
Scamp3 T C 3: 89,179,439 probably null Het
Sept8 A G 11: 53,537,870 H414R probably benign Het
Spata5 T A 3: 37,431,623 probably null Het
Spef2 T A 15: 9,614,195 probably null Het
Txlnb A G 10: 17,799,177 N26S probably damaging Het
Vmn1r11 G T 6: 57,138,064 V238L probably damaging Het
Other mutations in Cts8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Cts8 APN 13 61251578 missense probably damaging 1.00
IGL01343:Cts8 APN 13 61249196 unclassified probably benign
IGL01681:Cts8 APN 13 61253619 missense probably benign 0.01
IGL02264:Cts8 APN 13 61250958 missense probably damaging 1.00
IGL02686:Cts8 APN 13 61250970 missense probably benign 0.09
IGL03196:Cts8 APN 13 61253458 missense probably benign 0.05
R0123:Cts8 UTSW 13 61253577 missense probably benign 0.01
R0630:Cts8 UTSW 13 61253442 missense possibly damaging 0.71
R0856:Cts8 UTSW 13 61250916 missense probably damaging 1.00
R1932:Cts8 UTSW 13 61253615 missense probably damaging 0.98
R2186:Cts8 UTSW 13 61251731 missense probably damaging 1.00
R3103:Cts8 UTSW 13 61250958 missense probably damaging 1.00
R3772:Cts8 UTSW 13 61250901 splice site probably benign
R5127:Cts8 UTSW 13 61253335 missense probably damaging 1.00
R5432:Cts8 UTSW 13 61251012 missense probably benign 0.00
R6088:Cts8 UTSW 13 61253966 missense probably benign 0.01
R6298:Cts8 UTSW 13 61249223 missense possibly damaging 0.77
R6501:Cts8 UTSW 13 61250942 missense probably damaging 1.00
X0062:Cts8 UTSW 13 61251008 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCAGATGATTGGGAGATGCTCGGC -3'
(R):5'- GCAGACTTGGGGAAACTCTGCTAC -3'

Sequencing Primer
(F):5'- cagtttctcttgtttcgatgacc -3'
(R):5'- CTTGGGGAAACTCTGCTACAAAATG -3'
Posted OnNov 08, 2013