Incidental Mutation 'R0891:Gen1'
ID83508
Institutional Source Beutler Lab
Gene Symbol Gen1
Ensembl Gene ENSMUSG00000051235
Gene NameGEN1, Holliday junction 5' flap endonuclease
Synonyms5830483C08Rik
MMRRC Submission 039054-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R0891 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location11238920-11265801 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 11248354 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166117] [ENSMUST00000218487] [ENSMUST00000218547]
Predicted Effect probably benign
Transcript: ENSMUST00000166117
SMART Domains Protein: ENSMUSP00000132098
Gene: ENSMUSG00000051235

DomainStartEndE-ValueType
XPGN 1 96 9.13e-22 SMART
XPGI 122 193 5.32e-23 SMART
HhH2 195 229 2.87e-5 SMART
low complexity region 704 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218487
Predicted Effect probably benign
Transcript: ENSMUST00000218547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220261
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 96.7%
  • 20x: 92.2%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rad2/xeroderma pigmentosum group G nuclease family, whose members are characterized by N-terminal and internal xeroderma pigmentosum group G nuclease domains followed by helix-hairpin-helix domains and disordered C-terminal domains. The protein encoded by this gene is involved in resolution of Holliday junctions, which are intermediate four-way structures that covalently link DNA during homologous recombination and double-strand break repair. The protein resolves Holliday junctions by creating dual incisions across the junction to produce nicked duplex products that can be ligated. In addition, this protein has been found to localize to centrosomes where it has been implicated in regulation of centrosome integrity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,290 N567K possibly damaging Het
9930021J03Rik G A 19: 29,717,653 T1547I probably damaging Het
Afap1 G A 5: 35,961,852 probably null Het
Angel2 G T 1: 190,945,073 K517N possibly damaging Het
Ankrd36 A G 11: 5,687,316 E1295G possibly damaging Het
Ankrd45 A G 1: 161,155,336 N139S possibly damaging Het
Ano3 T C 2: 110,697,976 T498A probably benign Het
Arhgap12 T C 18: 6,026,699 T720A probably damaging Het
Brsk1 A G 7: 4,704,227 S260G possibly damaging Het
Calml3 A G 13: 3,803,926 F93S probably damaging Het
Ccnf G T 17: 24,226,777 H498Q possibly damaging Het
Col27a1 A C 4: 63,305,183 probably null Het
Cpne5 A G 17: 29,202,919 probably benign Het
Dcst1 G A 3: 89,353,277 T560I probably benign Het
Fndc7 A G 3: 108,870,588 Y351H possibly damaging Het
Gm5415 T A 1: 32,546,361 H156L possibly damaging Het
Kcnh8 A T 17: 52,905,214 D680V probably damaging Het
Kmt2d A G 15: 98,852,691 probably benign Het
Lrrfip1 T A 1: 91,068,615 I50N probably damaging Het
Mbip A T 12: 56,340,457 D132E possibly damaging Het
Nipal3 A T 4: 135,468,587 I235N possibly damaging Het
Nup93 T A 8: 94,281,263 probably benign Het
Olfr1347 T A 7: 6,488,472 Y134F probably damaging Het
Olfr524 A G 7: 140,202,459 Y104H probably damaging Het
Pgbd1 T C 13: 21,422,800 Y408C probably damaging Het
Pigo G A 4: 43,020,519 Q808* probably null Het
Pik3r1 A T 13: 101,701,466 N299K probably benign Het
Pip5k1a A G 3: 95,065,520 probably benign Het
Sept5 G C 16: 18,624,845 T118R probably damaging Het
Smarcal1 T C 1: 72,598,856 V483A probably damaging Het
Togaram1 A G 12: 64,982,647 D948G probably benign Het
Vmn2r75 A T 7: 86,164,268 V442E possibly damaging Het
Zfp57 A G 17: 37,006,176 K46E probably damaging Het
Other mutations in Gen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Gen1 APN 12 11261067 missense probably damaging 1.00
IGL01308:Gen1 APN 12 11256870 missense probably damaging 1.00
IGL01384:Gen1 APN 12 11255241 missense probably benign 0.00
IGL01766:Gen1 APN 12 11256894 missense probably damaging 1.00
IGL02132:Gen1 APN 12 11241866 missense probably benign 0.37
IGL02191:Gen1 APN 12 11242296 missense probably benign 0.18
IGL02452:Gen1 APN 12 11242575 missense probably benign 0.02
IGL02479:Gen1 APN 12 11241935 missense probably benign 0.01
IGL02690:Gen1 APN 12 11241575 missense probably damaging 0.96
IGL03095:Gen1 APN 12 11248264 missense probably benign 0.38
PIT4520001:Gen1 UTSW 12 11241508 missense probably benign 0.12
R0014:Gen1 UTSW 12 11241641 missense probably benign 0.44
R0014:Gen1 UTSW 12 11241641 missense probably benign 0.44
R0355:Gen1 UTSW 12 11248354 splice site probably benign
R0680:Gen1 UTSW 12 11241869 missense probably benign 0.06
R1192:Gen1 UTSW 12 11255218 missense probably damaging 0.97
R1353:Gen1 UTSW 12 11243219 missense probably benign 0.00
R1833:Gen1 UTSW 12 11248351 splice site probably benign
R1898:Gen1 UTSW 12 11241608 missense probably benign 0.10
R2138:Gen1 UTSW 12 11241621 missense probably damaging 1.00
R2185:Gen1 UTSW 12 11261040 missense probably null 0.95
R2409:Gen1 UTSW 12 11249164 missense possibly damaging 0.75
R2876:Gen1 UTSW 12 11242068 missense probably benign 0.13
R3815:Gen1 UTSW 12 11252033 missense possibly damaging 0.84
R4402:Gen1 UTSW 12 11242362 missense possibly damaging 0.71
R4572:Gen1 UTSW 12 11242418 missense probably damaging 0.99
R4900:Gen1 UTSW 12 11241560 missense probably benign 0.00
R5091:Gen1 UTSW 12 11246346 missense probably damaging 0.97
R5952:Gen1 UTSW 12 11260896 missense probably damaging 0.96
R6785:Gen1 UTSW 12 11262530 missense possibly damaging 0.89
R6869:Gen1 UTSW 12 11241441 missense probably benign 0.02
R7057:Gen1 UTSW 12 11242418 missense probably benign 0.21
R7155:Gen1 UTSW 12 11241832 missense probably benign 0.25
R7260:Gen1 UTSW 12 11256848 missense probably damaging 0.99
R7316:Gen1 UTSW 12 11241469 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGCTTTCCTTGACTTTTGGAGAACAG -3'
(R):5'- TCTCAACCAGGTTGTCATTTGACACC -3'

Sequencing Primer
(F):5'- agccagaagaaggcatcag -3'
(R):5'- AGGTTGTCATTTGACACCTTCTC -3'
Posted On2013-11-08