Incidental Mutation 'R0892:Oog2'
ID83528
Institutional Source Beutler Lab
Gene Symbol Oog2
Ensembl Gene ENSMUSG00000066030
Gene Nameoogenesin 2
Synonyms
MMRRC Submission 039055-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R0892 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location144190719-144196934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 144196499 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 445 (T445S)
Ref Sequence ENSEMBL: ENSMUSP00000079267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080405] [ENSMUST00000143978]
Predicted Effect probably benign
Transcript: ENSMUST00000080405
AA Change: T445S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000079267
Gene: ENSMUSG00000066030
AA Change: T445S

DomainStartEndE-ValueType
SCOP:d1a4ya_ 204 391 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141847
Predicted Effect probably benign
Transcript: ENSMUST00000143978
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,382,248 probably null Het
Abca13 T A 11: 9,298,305 V2684E probably benign Het
Ankub1 T C 3: 57,690,379 R57G probably benign Het
Bcr C T 10: 75,125,063 A442V probably benign Het
Cd46 T C 1: 195,082,612 T226A possibly damaging Het
Dmkn C T 7: 30,767,404 R114C probably damaging Het
Ell2 A T 13: 75,763,639 N348I probably damaging Het
Epg5 T A 18: 77,968,628 I830N possibly damaging Het
Gm15737 C T 6: 92,879,740 probably benign Het
Gpa33 A G 1: 166,157,642 N182S probably damaging Het
Gpr37 A T 6: 25,688,207 I297N probably damaging Het
Hpse2 T C 19: 43,388,146 K56E probably benign Het
Lamc1 G A 1: 153,332,254 H96Y possibly damaging Het
Mapre2 A G 18: 23,858,143 N189S probably benign Het
Msmo1 T A 8: 64,722,553 I148F possibly damaging Het
Myh6 T C 14: 54,947,054 T1607A probably benign Het
Olfr1484 T A 19: 13,585,517 V28D probably damaging Het
Plag1 G A 4: 3,904,532 Q220* probably null Het
Pom121l2 A G 13: 21,982,474 E305G possibly damaging Het
Sbsn A T 7: 30,754,819 Q50L possibly damaging Het
Slc25a42 A G 8: 70,191,947 L34P probably damaging Het
Sptbn1 C A 11: 30,142,201 R521S probably damaging Het
St14 A T 9: 31,100,428 V394E probably benign Het
Tatdn3 T C 1: 191,062,805 D18G probably benign Het
Trappc8 A G 18: 20,831,608 probably null Het
Other mutations in Oog2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Oog2 APN 4 144195172 missense probably damaging 1.00
IGL01317:Oog2 APN 4 144195267 missense probably benign 0.16
IGL01697:Oog2 APN 4 144195184 missense possibly damaging 0.90
IGL02237:Oog2 APN 4 144196446 missense possibly damaging 0.95
IGL02411:Oog2 APN 4 144195048 missense probably damaging 0.99
IGL02476:Oog2 APN 4 144195229 missense probably benign 0.02
IGL03284:Oog2 APN 4 144196607 unclassified probably benign
IGL03394:Oog2 APN 4 144194006 missense probably benign 0.17
R0538:Oog2 UTSW 4 144196084 nonsense probably null
R1024:Oog2 UTSW 4 144196286 missense probably damaging 1.00
R4156:Oog2 UTSW 4 144193953 intron probably benign
R4157:Oog2 UTSW 4 144193953 intron probably benign
R4166:Oog2 UTSW 4 144194841 missense probably damaging 1.00
R4167:Oog2 UTSW 4 144196212 missense probably benign 0.18
R4732:Oog2 UTSW 4 144193941 intron probably benign
R4734:Oog2 UTSW 4 144196451 missense probably benign 0.00
R4741:Oog2 UTSW 4 144195145 missense possibly damaging 0.94
R4909:Oog2 UTSW 4 144195099 missense possibly damaging 0.78
R4954:Oog2 UTSW 4 144190732 start gained probably benign
R6437:Oog2 UTSW 4 144195108 unclassified probably null
R6487:Oog2 UTSW 4 144196485 missense possibly damaging 0.48
R6946:Oog2 UTSW 4 144196464 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTGCCTGCCCTAAGTCAATGTTACC -3'
(R):5'- TTCCTTCCAGCAAGGGACATTCAC -3'

Sequencing Primer
(F):5'- GTCAATGTTACCAGCTCACAGTAG -3'
(R):5'- GACATTCACTTAGGATATCAATTCCC -3'
Posted On2013-11-08