Incidental Mutation 'R0892:St14'
ID 83537
Institutional Source Beutler Lab
Gene Symbol St14
Ensembl Gene ENSMUSG00000031995
Gene Name suppression of tumorigenicity 14 (colon carcinoma)
Synonyms Tmprss14, matriptase, Prss14, Epithin, MT-SP1
MMRRC Submission 039055-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0892 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 31000698-31043149 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 31011724 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 394 (V394E)
Ref Sequence ENSEMBL: ENSMUSP00000034478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034478]
AlphaFold P56677
Predicted Effect probably benign
Transcript: ENSMUST00000034478
AA Change: V394E

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034478
Gene: ENSMUSG00000031995
AA Change: V394E

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
Pfam:SEA 88 181 7.9e-17 PFAM
CUB 214 334 4.24e-14 SMART
CUB 340 447 4.37e-25 SMART
LDLa 452 486 2.31e-9 SMART
LDLa 487 523 4.08e-10 SMART
LDLa 524 561 3.98e-13 SMART
LDLa 566 604 1.48e-7 SMART
Tryp_SPc 614 849 1.25e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217404
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial-derived, integral membrane serine protease. This protease forms a complex with the Kunitz-type serine protease inhibitor, HAI-1, and is found to be activated by sphingosine 1-phosphate. This protease has been shown to cleave and activate hepatocyte growth factor/scattering factor, and urokinase plasminogen activator, which suggest the function of this protease as an epithelial membrane activator for other proteases and latent growth factors. The expression of this protease has been associated with breast, colon, prostate, and ovarian tumors, which implicates its role in cancer invasion, and metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this locus results in pleiotropic defects affecting the development of the epidermis, hair follicles, and immune system. Mutant mice become dehydrated due to impaired epidermal barrier function and die within days of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,248,305 (GRCm39) V2684E probably benign Het
Ankub1 T C 3: 57,597,800 (GRCm39) R57G probably benign Het
Bcr C T 10: 74,960,895 (GRCm39) A442V probably benign Het
Cd46 T C 1: 194,764,920 (GRCm39) T226A possibly damaging Het
Dmkn C T 7: 30,466,829 (GRCm39) R114C probably damaging Het
Ell2 A T 13: 75,911,758 (GRCm39) N348I probably damaging Het
Epg5 T A 18: 78,011,843 (GRCm39) I830N possibly damaging Het
Gm15737 C T 6: 92,856,721 (GRCm39) probably benign Het
Gpa33 A G 1: 165,985,211 (GRCm39) N182S probably damaging Het
Gpr37 A T 6: 25,688,206 (GRCm39) I297N probably damaging Het
Hpse2 T C 19: 43,376,585 (GRCm39) K56E probably benign Het
Lamc1 G A 1: 153,208,000 (GRCm39) H96Y possibly damaging Het
Mapre2 A G 18: 23,991,200 (GRCm39) N189S probably benign Het
Msmo1 T A 8: 65,175,587 (GRCm39) I148F possibly damaging Het
Myh6 T C 14: 55,184,511 (GRCm39) T1607A probably benign Het
Oog2 A T 4: 143,923,069 (GRCm39) T445S probably benign Het
Or5b122 T A 19: 13,562,881 (GRCm39) V28D probably damaging Het
Plag1 G A 4: 3,904,532 (GRCm39) Q220* probably null Het
Pom121l2 A G 13: 22,166,644 (GRCm39) E305G possibly damaging Het
Prorp A G 12: 55,429,033 (GRCm39) probably null Het
Sbsn A T 7: 30,454,244 (GRCm39) Q50L possibly damaging Het
Slc25a42 A G 8: 70,644,597 (GRCm39) L34P probably damaging Het
Sptbn1 C A 11: 30,092,201 (GRCm39) R521S probably damaging Het
Tatdn3 T C 1: 190,795,002 (GRCm39) D18G probably benign Het
Trappc8 A G 18: 20,964,665 (GRCm39) probably null Het
Other mutations in St14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:St14 APN 9 31,015,075 (GRCm39) missense probably damaging 1.00
IGL01443:St14 APN 9 31,011,489 (GRCm39) nonsense probably null
IGL01816:St14 APN 9 31,019,563 (GRCm39) missense possibly damaging 0.71
IGL02100:St14 APN 9 31,011,426 (GRCm39) splice site probably benign
IGL02494:St14 APN 9 31,019,941 (GRCm39) missense possibly damaging 0.47
IGL02588:St14 APN 9 31,001,329 (GRCm39) splice site probably benign
IGL02663:St14 APN 9 31,011,678 (GRCm39) splice site probably null
IGL02711:St14 APN 9 31,001,196 (GRCm39) missense probably benign 0.05
IGL03130:St14 APN 9 31,008,367 (GRCm39) critical splice donor site probably null
IGL03296:St14 APN 9 31,020,008 (GRCm39) missense probably damaging 0.98
IGL03400:St14 APN 9 31,008,267 (GRCm39) splice site probably benign
R0101:St14 UTSW 9 31,008,403 (GRCm39) missense probably benign 0.23
R0225:St14 UTSW 9 31,019,580 (GRCm39) critical splice acceptor site probably null
R0335:St14 UTSW 9 31,002,620 (GRCm39) splice site probably benign
R1334:St14 UTSW 9 31,019,506 (GRCm39) missense probably damaging 1.00
R1487:St14 UTSW 9 31,008,476 (GRCm39) missense probably damaging 1.00
R1521:St14 UTSW 9 31,019,511 (GRCm39) missense probably benign 0.03
R1782:St14 UTSW 9 31,011,460 (GRCm39) missense probably damaging 1.00
R1920:St14 UTSW 9 31,001,166 (GRCm39) missense possibly damaging 0.94
R1921:St14 UTSW 9 31,001,166 (GRCm39) missense possibly damaging 0.94
R1922:St14 UTSW 9 31,001,166 (GRCm39) missense possibly damaging 0.94
R1933:St14 UTSW 9 31,017,508 (GRCm39) missense probably benign 0.00
R2070:St14 UTSW 9 31,002,669 (GRCm39) missense probably damaging 1.00
R2411:St14 UTSW 9 31,019,530 (GRCm39) missense probably benign 0.13
R4152:St14 UTSW 9 31,001,802 (GRCm39) missense probably benign 0.08
R4375:St14 UTSW 9 31,001,754 (GRCm39) missense probably benign 0.02
R4419:St14 UTSW 9 31,008,224 (GRCm39) missense probably damaging 1.00
R4747:St14 UTSW 9 31,015,053 (GRCm39) missense possibly damaging 0.78
R4791:St14 UTSW 9 31,006,918 (GRCm39) missense probably benign 0.27
R4915:St14 UTSW 9 31,019,960 (GRCm39) nonsense probably null
R5056:St14 UTSW 9 31,008,847 (GRCm39) splice site probably null
R5134:St14 UTSW 9 31,006,879 (GRCm39) missense probably benign 0.00
R5241:St14 UTSW 9 31,011,714 (GRCm39) nonsense probably null
R5325:St14 UTSW 9 31,008,274 (GRCm39) splice site probably null
R5644:St14 UTSW 9 31,017,806 (GRCm39) missense probably benign
R5828:St14 UTSW 9 31,002,803 (GRCm39) missense probably damaging 1.00
R5922:St14 UTSW 9 31,041,200 (GRCm39) intron probably benign
R5930:St14 UTSW 9 31,015,056 (GRCm39) missense probably damaging 1.00
R5963:St14 UTSW 9 31,017,853 (GRCm39) intron probably benign
R6911:St14 UTSW 9 31,018,081 (GRCm39) missense probably benign 0.00
R6937:St14 UTSW 9 31,040,956 (GRCm39) splice site probably null
R6986:St14 UTSW 9 31,007,845 (GRCm39) missense probably damaging 0.98
R7226:St14 UTSW 9 31,011,448 (GRCm39) missense possibly damaging 0.63
R7395:St14 UTSW 9 31,008,195 (GRCm39) missense probably benign 0.29
R7400:St14 UTSW 9 31,019,571 (GRCm39) missense probably benign 0.36
R8194:St14 UTSW 9 31,042,921 (GRCm39) start codon destroyed probably null 0.95
R8886:St14 UTSW 9 31,008,420 (GRCm39) missense possibly damaging 0.93
R9248:St14 UTSW 9 31,002,905 (GRCm39) missense probably damaging 1.00
R9440:St14 UTSW 9 31,007,845 (GRCm39) missense probably damaging 0.98
Z1177:St14 UTSW 9 31,001,803 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTCTAAAGCTACCGCAGTGAGATG -3'
(R):5'- CATAGGGCGTATGGGATTCGTTCAG -3'

Sequencing Primer
(F):5'- GTTGCTGCTCACCACAAACTG -3'
(R):5'- TCACTGCCCTCCCATGTTAA -3'
Posted On 2013-11-08