Incidental Mutation 'R0892:1110008L16Rik'
List |< first << previous [record 13 of 19097] next >> last >|
ID83542
Institutional Source Beutler Lab
Gene Symbol 1110008L16Rik
Ensembl Gene ENSMUSG00000021023
Gene NameRIKEN cDNA 1110008L16 gene
Synonyms
MMRRC Submission 039055-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R0892 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location55299577-55382533 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 55382248 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021411] [ENSMUST00000163070] [ENSMUST00000183475] [ENSMUST00000183654] [ENSMUST00000184766] [ENSMUST00000184980]
Predicted Effect probably null
Transcript: ENSMUST00000021411
SMART Domains Protein: ENSMUSP00000021411
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
Pfam:PRORP 339 575 4.8e-106 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163070
SMART Domains Protein: ENSMUSP00000124781
Gene: ENSMUSG00000021024

DomainStartEndE-ValueType
Pfam:Proteasome 13 201 1.5e-56 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000183475
SMART Domains Protein: ENSMUSP00000139252
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
low complexity region 410 424 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183654
SMART Domains Protein: ENSMUSP00000138821
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
Pfam:RNase_Zc3h12a 33 185 8e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000184766
SMART Domains Protein: ENSMUSP00000139204
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
PDB:4G26|A 153 581 1e-9 PDB
Predicted Effect probably null
Transcript: ENSMUST00000184980
SMART Domains Protein: ENSMUSP00000139123
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
low complexity region 113 127 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,298,305 V2684E probably benign Het
Ankub1 T C 3: 57,690,379 R57G probably benign Het
Bcr C T 10: 75,125,063 A442V probably benign Het
Cd46 T C 1: 195,082,612 T226A possibly damaging Het
Dmkn C T 7: 30,767,404 R114C probably damaging Het
Ell2 A T 13: 75,763,639 N348I probably damaging Het
Epg5 T A 18: 77,968,628 I830N possibly damaging Het
Gm15737 C T 6: 92,879,740 probably benign Het
Gpa33 A G 1: 166,157,642 N182S probably damaging Het
Gpr37 A T 6: 25,688,207 I297N probably damaging Het
Hpse2 T C 19: 43,388,146 K56E probably benign Het
Lamc1 G A 1: 153,332,254 H96Y possibly damaging Het
Mapre2 A G 18: 23,858,143 N189S probably benign Het
Msmo1 T A 8: 64,722,553 I148F possibly damaging Het
Myh6 T C 14: 54,947,054 T1607A probably benign Het
Olfr1484 T A 19: 13,585,517 V28D probably damaging Het
Oog2 A T 4: 144,196,499 T445S probably benign Het
Plag1 G A 4: 3,904,532 Q220* probably null Het
Pom121l2 A G 13: 21,982,474 E305G possibly damaging Het
Sbsn A T 7: 30,754,819 Q50L possibly damaging Het
Slc25a42 A G 8: 70,191,947 L34P probably damaging Het
Sptbn1 C A 11: 30,142,201 R521S probably damaging Het
St14 A T 9: 31,100,428 V394E probably benign Het
Tatdn3 T C 1: 191,062,805 D18G probably benign Het
Trappc8 A G 18: 20,831,608 probably null Het
Other mutations in 1110008L16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:1110008L16Rik APN 12 55308875 splice site probably benign
IGL01932:1110008L16Rik APN 12 55304125 missense probably benign
IGL03030:1110008L16Rik APN 12 55304644 missense probably damaging 1.00
R0102:1110008L16Rik UTSW 12 55382297 missense probably benign 0.37
R1479:1110008L16Rik UTSW 12 55379387 missense probably damaging 1.00
R1510:1110008L16Rik UTSW 12 55304212 missense probably benign 0.21
R1845:1110008L16Rik UTSW 12 55304332 missense possibly damaging 0.58
R1992:1110008L16Rik UTSW 12 55338206 missense probably damaging 1.00
R2307:1110008L16Rik UTSW 12 55304316 missense probably damaging 1.00
R4080:1110008L16Rik UTSW 12 55304613 missense possibly damaging 0.88
R4081:1110008L16Rik UTSW 12 55304613 missense possibly damaging 0.88
R4082:1110008L16Rik UTSW 12 55304613 missense possibly damaging 0.88
R5205:1110008L16Rik UTSW 12 55304441 nonsense probably null
R5590:1110008L16Rik UTSW 12 55304472 missense possibly damaging 0.89
R5940:1110008L16Rik UTSW 12 55304874 missense probably damaging 1.00
R5988:1110008L16Rik UTSW 12 55377217 missense probably damaging 1.00
R6147:1110008L16Rik UTSW 12 55379308 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCACAGCGAAACAATCCTGTAACTTAT -3'
(R):5'- CCAGGAGGCCATGCGACTCA -3'

Sequencing Primer
(F):5'- tgtggaaatggtaggaaaggg -3'
(R):5'- ATGCGACTCAGCAGGGG -3'
Posted On2013-11-08