Incidental Mutation 'R0893:Adnp'
ID83567
Institutional Source Beutler Lab
Gene Symbol Adnp
Ensembl Gene ENSMUSG00000051149
Gene Nameactivity-dependent neuroprotective protein
SynonymsmKIAA0784
MMRRC Submission 039056-MU
Accession Numbers

Genbank: NM_009628; MGI: 1338758

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0893 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location168180986-168207112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 168183727 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 549 (F549L)
Ref Sequence ENSEMBL: ENSMUSP00000085316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057793] [ENSMUST00000088001] [ENSMUST00000138667]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057793
AA Change: F549L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056809
Gene: ENSMUSG00000051149
AA Change: F549L

DomainStartEndE-ValueType
ZnF_C2H2 74 97 6.57e0 SMART
ZnF_C2H2 107 129 1.77e1 SMART
low complexity region 130 141 N/A INTRINSIC
ZnF_C2H2 165 188 1.29e1 SMART
ZnF_C2H2 221 244 1.4e1 SMART
low complexity region 423 437 N/A INTRINSIC
ZnF_C2H2 446 468 8.62e1 SMART
ZnF_C2H2 488 509 2.54e1 SMART
ZnF_C2H2 511 534 1.03e-2 SMART
low complexity region 582 596 N/A INTRINSIC
ZnF_C2H2 621 646 1.27e2 SMART
HOX 756 817 2.95e-6 SMART
low complexity region 957 970 N/A INTRINSIC
low complexity region 1012 1023 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000088001
AA Change: F549L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000085316
Gene: ENSMUSG00000051149
AA Change: F549L

DomainStartEndE-ValueType
ZnF_C2H2 74 97 6.57e0 SMART
ZnF_C2H2 107 129 1.77e1 SMART
low complexity region 130 141 N/A INTRINSIC
ZnF_C2H2 165 188 1.29e1 SMART
ZnF_C2H2 221 244 1.4e1 SMART
low complexity region 423 437 N/A INTRINSIC
ZnF_C2H2 446 468 8.62e1 SMART
ZnF_C2H2 488 509 2.54e1 SMART
ZnF_C2H2 511 534 1.03e-2 SMART
low complexity region 582 596 N/A INTRINSIC
ZnF_C2H2 621 646 1.27e2 SMART
HOX 756 817 2.95e-6 SMART
low complexity region 957 970 N/A INTRINSIC
low complexity region 1012 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138667
SMART Domains Protein: ENSMUSP00000139070
Gene: ENSMUSG00000093752

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 24 240 1.1e-13 PFAM
Pfam:Glyco_tranf_2_2 28 153 8.4e-10 PFAM
Pfam:Glycos_transf_2 28 199 3.8e-40 PFAM
Pfam:Glyco_transf_21 87 200 1.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139984
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: This gene encodes a member of a protein family characterized by nine zinc finger motifs followed by a homeobox domain. In vitro studies demonstrate that the encoded protein interacts with the brahma-related gene1-associated or hBRM factors (BAF) gene expression regulating complex, components of the protein translation machinery, and microtubule-associated proteins. This gene has been implicated in neuroprotection through various processes that include chromatin remodeling, splicing, cytoskeletal reorganization, and autophagy. Homozygous mutant knockout mice display embryonic lethality with defects in neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Developmental defects including the failure of the cranial neural tube to close lead to embryonic death between E8.5 and E9. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,219,308 probably benign Het
4921501E09Rik T C 17: 33,065,289 I846M probably benign Het
Agl A G 3: 116,753,286 I1305T probably benign Het
Aldh8a1 T A 10: 21,391,694 M326K probably benign Het
Amdhd1 A T 10: 93,527,651 M295K probably damaging Het
Arhgef4 T A 1: 34,807,110 C324S probably damaging Het
Car8 A T 4: 8,238,119 probably null Het
Cc2d1a T C 8: 84,140,839 probably benign Het
Cd81 G A 7: 143,062,505 V27M possibly damaging Het
Ces1b A T 8: 93,079,428 S62T probably benign Het
Cfb A G 17: 34,858,055 S30P probably damaging Het
Cmtm3 A G 8: 104,343,911 M101V possibly damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Ddb1 C T 19: 10,612,916 S269L probably benign Het
Ddx25 G A 9: 35,554,390 Q143* probably null Het
Dis3l2 T A 1: 87,044,206 probably null Het
Dlgap4 G T 2: 156,745,978 E598* probably null Het
Dus1l C T 11: 120,789,436 G471D possibly damaging Het
Elp4 C A 2: 105,896,945 probably benign Het
Eya3 A G 4: 132,689,786 N194S probably benign Het
Gm9992 A G 17: 7,374,527 L174P probably damaging Het
Golgb1 G T 16: 36,912,277 V629L possibly damaging Het
Hars2 G A 18: 36,787,595 A164T possibly damaging Het
Hexb T A 13: 97,185,627 I217L probably benign Het
Hgh1 A G 15: 76,369,648 probably null Het
Hsd3b3 A T 3: 98,742,441 probably null Het
Ighg2c T A 12: 113,287,433 N321Y unknown Het
Il5 A G 11: 53,720,936 T34A probably benign Het
Jph1 C A 1: 17,004,283 E504* probably null Het
Kif2b G T 11: 91,575,594 T621K probably benign Het
Kmt2c A T 5: 25,351,270 probably benign Het
Leprotl1 A G 8: 34,138,852 probably null Het
Lpar3 C T 3: 146,240,593 R9C possibly damaging Het
Map1a A G 2: 121,300,533 E372G probably damaging Het
Map2 C A 1: 66,380,768 T86K probably damaging Het
Map7 A G 10: 20,273,883 probably null Het
Mdn1 T C 4: 32,701,713 V1482A probably benign Het
Mks1 G A 11: 87,856,951 probably benign Het
Morf4l1 T G 9: 90,102,350 K102N probably damaging Het
Mroh1 T A 15: 76,408,938 V304D possibly damaging Het
Mtg1 G A 7: 140,149,752 V252M probably damaging Het
Myh13 A T 11: 67,334,601 D264V probably damaging Het
Myh2 A G 11: 67,186,508 Y823C possibly damaging Het
Myoz1 A T 14: 20,651,184 S112R probably benign Het
Ncapd2 A G 6: 125,173,482 V860A probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Npffr1 T C 10: 61,614,231 F95L possibly damaging Het
Olfr585 G T 7: 103,098,434 R231L probably benign Het
Olfr877 T C 9: 37,855,196 I126T probably damaging Het
Orc4 A C 2: 48,932,610 probably benign Het
P3h3 A C 6: 124,845,513 I565R probably damaging Het
Pak4 T C 7: 28,559,777 D552G probably benign Het
Pcdhb4 G T 18: 37,309,370 probably null Het
Pdcd4 G T 19: 53,929,094 R454L probably damaging Het
Pkd1l2 A G 8: 117,044,492 I1116T probably damaging Het
Plcb2 A G 2: 118,725,105 probably benign Het
Pmpca T C 2: 26,393,218 probably benign Het
Pnpla7 T A 2: 24,997,240 I32N probably damaging Het
Prpf8 A G 11: 75,493,949 K718E probably damaging Het
Racgap1 C T 15: 99,626,530 A359T probably benign Het
Rgs3 G A 4: 62,605,561 probably null Het
Rhpn1 A G 15: 75,711,654 E356G probably damaging Het
Rps6ka5 T C 12: 100,574,438 H488R possibly damaging Het
Scn11a A G 9: 119,803,330 probably null Het
Sema4f A T 6: 82,935,967 probably benign Het
Serpina1f A G 12: 103,693,835 S63P probably damaging Het
Slc9a3 T C 13: 74,159,246 W386R probably damaging Het
Slc9b1 A C 3: 135,394,890 L465F probably benign Het
Smc5 A G 19: 23,263,653 V165A possibly damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tinagl1 G T 4: 130,174,023 D59E probably damaging Het
Tns3 A G 11: 8,493,302 Y354H probably damaging Het
Trappc9 C T 15: 72,590,107 G1103D probably damaging Het
Unc79 A T 12: 102,991,428 D34V probably damaging Het
Unc80 T C 1: 66,521,486 L791P probably damaging Het
Xpo7 G T 14: 70,666,097 probably benign Het
Zbtb1 T A 12: 76,385,339 I33N probably damaging Het
Other mutations in Adnp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Adnp APN 2 168182562 missense probably benign
IGL00500:Adnp APN 2 168183323 missense possibly damaging 0.85
IGL01604:Adnp APN 2 168184338 missense probably damaging 0.99
IGL01967:Adnp APN 2 168183419 missense possibly damaging 0.85
IGL02470:Adnp APN 2 168183194 missense probably damaging 0.99
C9142:Adnp UTSW 2 168184407 missense probably damaging 0.99
R1167:Adnp UTSW 2 168184500 missense probably benign 0.11
R1182:Adnp UTSW 2 168184796 missense possibly damaging 0.77
R1480:Adnp UTSW 2 168183534 missense probably damaging 0.99
R1505:Adnp UTSW 2 168183741 missense possibly damaging 0.93
R1906:Adnp UTSW 2 168182367 missense probably benign
R3711:Adnp UTSW 2 168184823 missense probably damaging 0.98
R3943:Adnp UTSW 2 168185060 missense possibly damaging 0.92
R4440:Adnp UTSW 2 168184801 missense possibly damaging 0.92
R4686:Adnp UTSW 2 168182389 missense possibly damaging 0.78
R4916:Adnp UTSW 2 168187617 missense possibly damaging 0.91
R5072:Adnp UTSW 2 168183001 missense probably damaging 0.96
R5312:Adnp UTSW 2 168184188 missense probably benign
R5393:Adnp UTSW 2 168182949 missense possibly damaging 0.95
R5598:Adnp UTSW 2 168183725 missense probably damaging 0.99
R6230:Adnp UTSW 2 168182532 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGAGGGCAAAGGGTCTTCCCAAC -3'
(R):5'- GAGAAAGTCCCAGCCGTAGCTAAC -3'

Sequencing Primer
(F):5'- CAGCTTGAGGTGAACTTTTAACCG -3'
(R):5'- GCAAATGCCTCTACTGTAATCG -3'
Posted On2013-11-08