Incidental Mutation 'R0893:Mtg1'
ID83585
Institutional Source Beutler Lab
Gene Symbol Mtg1
Ensembl Gene ENSMUSG00000039018
Gene Namemitochondrial ribosome-associated GTPase 1
SynonymsGtpbp7, LOC212508
MMRRC Submission 039056-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0893 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140137564-140150786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 140149752 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 252 (V252M)
Ref Sequence ENSEMBL: ENSMUSP00000036491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036977] [ENSMUST00000059241]
Predicted Effect probably damaging
Transcript: ENSMUST00000036977
AA Change: V252M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036491
Gene: ENSMUSG00000039018
AA Change: V252M

DomainStartEndE-ValueType
SCOP:d1egaa1 31 129 5e-6 SMART
Pfam:FeoB_N 143 219 3.9e-6 PFAM
Pfam:MMR_HSR1 144 283 2.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059241
SMART Domains Protein: ENSMUSP00000053901
Gene: ENSMUSG00000045733

DomainStartEndE-ValueType
Pfam:Shadoo 19 147 7.2e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155723
Predicted Effect probably benign
Transcript: ENSMUST00000156791
Predicted Effect probably benign
Transcript: ENSMUST00000211171
Meta Mutation Damage Score 0.272 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,219,308 probably benign Het
4921501E09Rik T C 17: 33,065,289 I846M probably benign Het
Adnp A T 2: 168,183,727 F549L possibly damaging Het
Agl A G 3: 116,753,286 I1305T probably benign Het
Aldh8a1 T A 10: 21,391,694 M326K probably benign Het
Amdhd1 A T 10: 93,527,651 M295K probably damaging Het
Arhgef4 T A 1: 34,807,110 C324S probably damaging Het
Car8 A T 4: 8,238,119 probably null Het
Cc2d1a T C 8: 84,140,839 probably benign Het
Cd81 G A 7: 143,062,505 V27M possibly damaging Het
Ces1b A T 8: 93,079,428 S62T probably benign Het
Cfb A G 17: 34,858,055 S30P probably damaging Het
Cmtm3 A G 8: 104,343,911 M101V possibly damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Ddb1 C T 19: 10,612,916 S269L probably benign Het
Ddx25 G A 9: 35,554,390 Q143* probably null Het
Dis3l2 T A 1: 87,044,206 probably null Het
Dlgap4 G T 2: 156,745,978 E598* probably null Het
Dus1l C T 11: 120,789,436 G471D possibly damaging Het
Elp4 C A 2: 105,896,945 probably benign Het
Eya3 A G 4: 132,689,786 N194S probably benign Het
Gm9992 A G 17: 7,374,527 L174P probably damaging Het
Golgb1 G T 16: 36,912,277 V629L possibly damaging Het
Hars2 G A 18: 36,787,595 A164T possibly damaging Het
Hexb T A 13: 97,185,627 I217L probably benign Het
Hgh1 A G 15: 76,369,648 probably null Het
Hsd3b3 A T 3: 98,742,441 probably null Het
Ighg2c T A 12: 113,287,433 N321Y unknown Het
Il5 A G 11: 53,720,936 T34A probably benign Het
Jph1 C A 1: 17,004,283 E504* probably null Het
Kif2b G T 11: 91,575,594 T621K probably benign Het
Kmt2c A T 5: 25,351,270 probably benign Het
Leprotl1 A G 8: 34,138,852 probably null Het
Lpar3 C T 3: 146,240,593 R9C possibly damaging Het
Map1a A G 2: 121,300,533 E372G probably damaging Het
Map2 C A 1: 66,380,768 T86K probably damaging Het
Map7 A G 10: 20,273,883 probably null Het
Mdn1 T C 4: 32,701,713 V1482A probably benign Het
Mks1 G A 11: 87,856,951 probably benign Het
Morf4l1 T G 9: 90,102,350 K102N probably damaging Het
Mroh1 T A 15: 76,408,938 V304D possibly damaging Het
Myh13 A T 11: 67,334,601 D264V probably damaging Het
Myh2 A G 11: 67,186,508 Y823C possibly damaging Het
Myoz1 A T 14: 20,651,184 S112R probably benign Het
Ncapd2 A G 6: 125,173,482 V860A probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Npffr1 T C 10: 61,614,231 F95L possibly damaging Het
Olfr585 G T 7: 103,098,434 R231L probably benign Het
Olfr877 T C 9: 37,855,196 I126T probably damaging Het
Orc4 A C 2: 48,932,610 probably benign Het
P3h3 A C 6: 124,845,513 I565R probably damaging Het
Pak4 T C 7: 28,559,777 D552G probably benign Het
Pcdhb4 G T 18: 37,309,370 probably null Het
Pdcd4 G T 19: 53,929,094 R454L probably damaging Het
Pkd1l2 A G 8: 117,044,492 I1116T probably damaging Het
Plcb2 A G 2: 118,725,105 probably benign Het
Pmpca T C 2: 26,393,218 probably benign Het
Pnpla7 T A 2: 24,997,240 I32N probably damaging Het
Prpf8 A G 11: 75,493,949 K718E probably damaging Het
Racgap1 C T 15: 99,626,530 A359T probably benign Het
Rgs3 G A 4: 62,605,561 probably null Het
Rhpn1 A G 15: 75,711,654 E356G probably damaging Het
Rps6ka5 T C 12: 100,574,438 H488R possibly damaging Het
Scn11a A G 9: 119,803,330 probably null Het
Sema4f A T 6: 82,935,967 probably benign Het
Serpina1f A G 12: 103,693,835 S63P probably damaging Het
Slc9a3 T C 13: 74,159,246 W386R probably damaging Het
Slc9b1 A C 3: 135,394,890 L465F probably benign Het
Smc5 A G 19: 23,263,653 V165A possibly damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tinagl1 G T 4: 130,174,023 D59E probably damaging Het
Tns3 A G 11: 8,493,302 Y354H probably damaging Het
Trappc9 C T 15: 72,590,107 G1103D probably damaging Het
Unc79 A T 12: 102,991,428 D34V probably damaging Het
Unc80 T C 1: 66,521,486 L791P probably damaging Het
Xpo7 G T 14: 70,666,097 probably benign Het
Zbtb1 T A 12: 76,385,339 I33N probably damaging Het
Other mutations in Mtg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Mtg1 APN 7 140150236 missense probably benign 0.00
IGL02105:Mtg1 APN 7 140150206 missense probably damaging 1.00
IGL02458:Mtg1 APN 7 140150172 missense probably benign 0.01
IGL02682:Mtg1 APN 7 140144729 splice site probably benign
R0666:Mtg1 UTSW 7 140144344 missense probably benign
R3707:Mtg1 UTSW 7 140149804 missense probably damaging 0.99
R4993:Mtg1 UTSW 7 140140283 missense probably null 1.00
R5810:Mtg1 UTSW 7 140145985 splice site probably null
R5886:Mtg1 UTSW 7 140149865 splice site probably null
R5960:Mtg1 UTSW 7 140146993 unclassified probably benign
R7069:Mtg1 UTSW 7 140143744 missense probably benign 0.00
R7110:Mtg1 UTSW 7 140146866 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGACACTTCTGTCCTGTACTGTCTTGG -3'
(R):5'- AGGTCCTTCCACCCTAGAAACTTCC -3'

Sequencing Primer
(F):5'- ttttacactgataggtgattaagtcc -3'
(R):5'- TAGAAACTTCCACAGTGTCCTG -3'
Posted On2013-11-08