Incidental Mutation 'R0893:Golgb1'
ID83623
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Namegolgi autoantigen, golgin subfamily b, macrogolgin 1
SynonymsGiantin, C130074L01Rik, F730017E11Rik, Gm6840, 6330407A06Rik
MMRRC Submission 039056-MU
Accession Numbers

Genbank: NM_030035.1

Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock #R0893 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location36875140-36933085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 36912277 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 629 (V629L)
Ref Sequence ENSEMBL: ENSMUSP00000110460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039855] [ENSMUST00000114812]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039855
AA Change: V670L

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000045239
Gene: ENSMUSG00000034243
AA Change: V670L

DomainStartEndE-ValueType
internal_repeat_2 24 61 7.47e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
coiled coil region 130 219 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
internal_repeat_3 519 558 7.47e-6 PROSPERO
coiled coil region 563 594 N/A INTRINSIC
internal_repeat_4 627 661 3.38e-5 PROSPERO
coiled coil region 679 1121 N/A INTRINSIC
coiled coil region 1153 1240 N/A INTRINSIC
internal_repeat_4 1253 1288 3.38e-5 PROSPERO
low complexity region 1300 1314 N/A INTRINSIC
internal_repeat_1 1321 1352 3.51e-6 PROSPERO
low complexity region 1357 1369 N/A INTRINSIC
coiled coil region 1402 1755 N/A INTRINSIC
internal_repeat_2 1760 1798 7.47e-6 PROSPERO
internal_repeat_3 1761 1804 7.47e-6 PROSPERO
coiled coil region 1818 2034 N/A INTRINSIC
low complexity region 2291 2306 N/A INTRINSIC
internal_repeat_1 2351 2382 3.51e-6 PROSPERO
low complexity region 2400 2418 N/A INTRINSIC
low complexity region 2538 2549 N/A INTRINSIC
coiled coil region 2775 2827 N/A INTRINSIC
coiled coil region 2854 2943 N/A INTRINSIC
low complexity region 2964 2976 N/A INTRINSIC
coiled coil region 3007 3057 N/A INTRINSIC
coiled coil region 3117 3163 N/A INTRINSIC
transmembrane domain 3215 3237 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114812
AA Change: V629L

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243
AA Change: V629L

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Meta Mutation Damage Score 0.1408 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,219,308 probably benign Het
4921501E09Rik T C 17: 33,065,289 I846M probably benign Het
Adnp A T 2: 168,183,727 F549L possibly damaging Het
Agl A G 3: 116,753,286 I1305T probably benign Het
Aldh8a1 T A 10: 21,391,694 M326K probably benign Het
Amdhd1 A T 10: 93,527,651 M295K probably damaging Het
Arhgef4 T A 1: 34,807,110 C324S probably damaging Het
Car8 A T 4: 8,238,119 probably null Het
Cc2d1a T C 8: 84,140,839 probably benign Het
Cd81 G A 7: 143,062,505 V27M possibly damaging Het
Ces1b A T 8: 93,079,428 S62T probably benign Het
Cfb A G 17: 34,858,055 S30P probably damaging Het
Cmtm3 A G 8: 104,343,911 M101V possibly damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Ddb1 C T 19: 10,612,916 S269L probably benign Het
Ddx25 G A 9: 35,554,390 Q143* probably null Het
Dis3l2 T A 1: 87,044,206 probably null Het
Dlgap4 G T 2: 156,745,978 E598* probably null Het
Dus1l C T 11: 120,789,436 G471D possibly damaging Het
Elp4 C A 2: 105,896,945 probably benign Het
Eya3 A G 4: 132,689,786 N194S probably benign Het
Gm9992 A G 17: 7,374,527 L174P probably damaging Het
Hars2 G A 18: 36,787,595 A164T possibly damaging Het
Hexb T A 13: 97,185,627 I217L probably benign Het
Hgh1 A G 15: 76,369,648 probably null Het
Hsd3b3 A T 3: 98,742,441 probably null Het
Ighg2c T A 12: 113,287,433 N321Y unknown Het
Il5 A G 11: 53,720,936 T34A probably benign Het
Jph1 C A 1: 17,004,283 E504* probably null Het
Kif2b G T 11: 91,575,594 T621K probably benign Het
Kmt2c A T 5: 25,351,270 probably benign Het
Leprotl1 A G 8: 34,138,852 probably null Het
Lpar3 C T 3: 146,240,593 R9C possibly damaging Het
Map1a A G 2: 121,300,533 E372G probably damaging Het
Map2 C A 1: 66,380,768 T86K probably damaging Het
Map7 A G 10: 20,273,883 probably null Het
Mdn1 T C 4: 32,701,713 V1482A probably benign Het
Mks1 G A 11: 87,856,951 probably benign Het
Morf4l1 T G 9: 90,102,350 K102N probably damaging Het
Mroh1 T A 15: 76,408,938 V304D possibly damaging Het
Mtg1 G A 7: 140,149,752 V252M probably damaging Het
Myh13 A T 11: 67,334,601 D264V probably damaging Het
Myh2 A G 11: 67,186,508 Y823C possibly damaging Het
Myoz1 A T 14: 20,651,184 S112R probably benign Het
Ncapd2 A G 6: 125,173,482 V860A probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Npffr1 T C 10: 61,614,231 F95L possibly damaging Het
Olfr585 G T 7: 103,098,434 R231L probably benign Het
Olfr877 T C 9: 37,855,196 I126T probably damaging Het
Orc4 A C 2: 48,932,610 probably benign Het
P3h3 A C 6: 124,845,513 I565R probably damaging Het
Pak4 T C 7: 28,559,777 D552G probably benign Het
Pcdhb4 G T 18: 37,309,370 probably null Het
Pdcd4 G T 19: 53,929,094 R454L probably damaging Het
Pkd1l2 A G 8: 117,044,492 I1116T probably damaging Het
Plcb2 A G 2: 118,725,105 probably benign Het
Pmpca T C 2: 26,393,218 probably benign Het
Pnpla7 T A 2: 24,997,240 I32N probably damaging Het
Prpf8 A G 11: 75,493,949 K718E probably damaging Het
Racgap1 C T 15: 99,626,530 A359T probably benign Het
Rgs3 G A 4: 62,605,561 probably null Het
Rhpn1 A G 15: 75,711,654 E356G probably damaging Het
Rps6ka5 T C 12: 100,574,438 H488R possibly damaging Het
Scn11a A G 9: 119,803,330 probably null Het
Sema4f A T 6: 82,935,967 probably benign Het
Serpina1f A G 12: 103,693,835 S63P probably damaging Het
Slc9a3 T C 13: 74,159,246 W386R probably damaging Het
Slc9b1 A C 3: 135,394,890 L465F probably benign Het
Smc5 A G 19: 23,263,653 V165A possibly damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tinagl1 G T 4: 130,174,023 D59E probably damaging Het
Tns3 A G 11: 8,493,302 Y354H probably damaging Het
Trappc9 C T 15: 72,590,107 G1103D probably damaging Het
Unc79 A T 12: 102,991,428 D34V probably damaging Het
Unc80 T C 1: 66,521,486 L791P probably damaging Het
Xpo7 G T 14: 70,666,097 probably benign Het
Zbtb1 T A 12: 76,385,339 I33N probably damaging Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36931564 missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36915502 nonsense probably null
IGL01965:Golgb1 APN 16 36917920 missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36916304 missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36913128 missense probably benign 0.25
IGL02383:Golgb1 APN 16 36886200 missense probably benign 0.01
IGL02444:Golgb1 APN 16 36907816 splice site probably benign
IGL02635:Golgb1 APN 16 36915013 missense probably benign 0.00
IGL02655:Golgb1 APN 16 36918080 missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36925849 missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36916210 missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36912080 missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36925810 missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36912866 missense probably benign 0.11
IGL03109:Golgb1 APN 16 36915611 missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36913453 nonsense probably null
I2288:Golgb1 UTSW 16 36898542 missense probably benign 0.00
I2289:Golgb1 UTSW 16 36898542 missense probably benign 0.00
R0071:Golgb1 UTSW 16 36915503 missense probably benign 0.00
R0071:Golgb1 UTSW 16 36915503 missense probably benign 0.00
R0080:Golgb1 UTSW 16 36898611 missense probably damaging 1.00
R0102:Golgb1 UTSW 16 36875468 intron probably benign
R0242:Golgb1 UTSW 16 36875630 nonsense probably null
R0242:Golgb1 UTSW 16 36875630 nonsense probably null
R0276:Golgb1 UTSW 16 36913876 missense probably damaging 1.00
R0394:Golgb1 UTSW 16 36875579 intron probably benign
R0469:Golgb1 UTSW 16 36931635 missense probably benign 0.41
R0522:Golgb1 UTSW 16 36915205 frame shift probably null
R0575:Golgb1 UTSW 16 36918809 missense probably benign
R0600:Golgb1 UTSW 16 36916271 missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36916330 nonsense probably null
R0711:Golgb1 UTSW 16 36918790 missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36898790 missense possibly damaging 0.95
R1163:Golgb1 UTSW 16 36916126 missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36915205 frame shift probably null
R1315:Golgb1 UTSW 16 36914900 missense probably benign 0.40
R1429:Golgb1 UTSW 16 36900563 missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36919643 missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36898788 missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36926101 missense probably benign 0.25
R1659:Golgb1 UTSW 16 36887617 missense probably benign 0.01
R1769:Golgb1 UTSW 16 36916001 missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36914664 missense probably benign
R2212:Golgb1 UTSW 16 36887347 missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36893360 missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36898559 missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36912008 missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36918466 missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36915151 missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36894849 missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36887347 missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36918912 missense probably benign 0.00
R3847:Golgb1 UTSW 16 36898733 missense probably benign 0.00
R3850:Golgb1 UTSW 16 36898733 missense probably benign 0.00
R3936:Golgb1 UTSW 16 36914056 nonsense probably null
R3975:Golgb1 UTSW 16 36918571 missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36915344 missense probably benign 0.00
R4369:Golgb1 UTSW 16 36916907 missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36929263 missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36918625 missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36918625 missense probably damaging 1.00
R4660:Golgb1 UTSW 16 36887618 missense probably damaging 0.99
R4811:Golgb1 UTSW 16 36891419 missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36913115 missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36891407 missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36893386 missense probably damaging 1.00
R4916:Golgb1 UTSW 16 36916118 missense probably benign 0.05
R5121:Golgb1 UTSW 16 36919258 missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36891457 missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36898689 missense probably benign 0.09
R5185:Golgb1 UTSW 16 36875141 unclassified probably benign
R5188:Golgb1 UTSW 16 36918465 missense probably benign 0.13
R5260:Golgb1 UTSW 16 36913141 missense probably benign 0.00
R5297:Golgb1 UTSW 16 36875616 intron probably benign
R5386:Golgb1 UTSW 16 36912315 nonsense probably null
R5438:Golgb1 UTSW 16 36900508 missense probably benign 0.15
R5439:Golgb1 UTSW 16 36900508 missense probably benign 0.15
R5494:Golgb1 UTSW 16 36928683 missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36925763 missense probably benign 0.02
R5740:Golgb1 UTSW 16 36919000 missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36926091 splice site silent
R5928:Golgb1 UTSW 16 36911987 missense probably damaging 1.00
R6009:Golgb1 UTSW 16 36914959 missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36914671 missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36912865 missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36893395 missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36915622 missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36913978 missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36918197 nonsense probably null
R6700:Golgb1 UTSW 16 36875584 intron probably benign
R6870:Golgb1 UTSW 16 36918203 missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36913990 missense probably benign
R6944:Golgb1 UTSW 16 36912113 missense probably benign
R7108:Golgb1 UTSW 16 36913721 missense probably benign 0.01
R7124:Golgb1 UTSW 16 36913673 missense probably benign 0.01
R7125:Golgb1 UTSW 16 36917963 missense possibly damaging 0.85
V1662:Golgb1 UTSW 16 36898542 missense probably benign 0.00
X0067:Golgb1 UTSW 16 36914303 nonsense probably null
Z1088:Golgb1 UTSW 16 36919742 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGGTCCTCGACCGTAGAGAAG -3'
(R):5'- CCCGCAGTTCTGCTAAGACATCAAG -3'

Sequencing Primer
(F):5'- CTCGACCGTAGAGAAGTGCAG -3'
(R):5'- TCCTTCACCTGGTAAAGCAG -3'
Posted On2013-11-08