Incidental Mutation 'R0894:Dync2h1'
ID83671
Institutional Source Beutler Lab
Gene Symbol Dync2h1
Ensembl Gene ENSMUSG00000047193
Gene Namedynein cytoplasmic 2 heavy chain 1
Synonyms4432416O06Rik, DHC2, D030010H02Rik, D330044F14Rik, Dnchc2, DHC1b, b2b414Clo
MMRRC Submission 039057-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0894 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location6928503-7184446 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 7041734 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048417] [ENSMUST00000140466] [ENSMUST00000147193]
Predicted Effect probably benign
Transcript: ENSMUST00000048417
SMART Domains Protein: ENSMUSP00000046733
Gene: ENSMUSG00000047193

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139671
SMART Domains Protein: ENSMUSP00000116242
Gene: ENSMUSG00000047193

DomainStartEndE-ValueType
low complexity region 59 73 N/A INTRINSIC
Pfam:AAA_8 89 352 3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140466
SMART Domains Protein: ENSMUSP00000120007
Gene: ENSMUSG00000047193

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147193
SMART Domains Protein: ENSMUSP00000116679
Gene: ENSMUSG00000047193

DomainStartEndE-ValueType
Pfam:DHC_N1 188 674 4e-45 PFAM
Pfam:DHC_N2 1118 1521 5.5e-111 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2880 4.4e-27 PFAM
Pfam:MT 2894 3230 1.3e-27 PFAM
Pfam:AAA_9 3246 3477 1e-79 PFAM
Pfam:Dynein_heavy 3618 4310 8.5e-158 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency 97% (102/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large cytoplasmic dynein protein that is involved in retrograde transport in the cilium and has a role in intraflagellar transport, a process required for ciliary/flagellar assembly. Mutations in this gene cause a heterogeneous spectrum of conditions related to altered primary cilium function and often involve polydactyly, abnormal skeletogenesis, and polycystic kidneys. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a gene trap allele show complete embryonic lethality with altered heart looping and brain morphology. Chemically induced mutants show randomized heart looping and polydactyly. Holoprosencephaly or exencephaly, micrognathia, and cardiac, renal, airway and eye defects may be observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A T 19: 58,787,583 L138Q probably damaging Het
1700028P14Rik T C 19: 23,652,698 E10G unknown Het
1700029J07Rik A G 8: 45,956,460 F274S probably damaging Het
2210408I21Rik A G 13: 77,323,607 S1044G probably benign Het
4930578C19Rik T A X: 18,423,552 I224F possibly damaging Het
4931409K22Rik T C 5: 24,550,733 probably null Het
9930021J03Rik T C 19: 29,720,574 probably benign Het
Aanat A G 11: 116,596,904 H143R probably benign Het
Abca8a A G 11: 110,050,966 I1159T probably benign Het
Abcb1a G T 5: 8,674,856 probably benign Het
Abcc1 T C 16: 14,465,137 V1159A possibly damaging Het
Akr1e1 T A 13: 4,595,072 Q204L probably damaging Het
Alk T C 17: 71,895,935 Y1135C probably damaging Het
Atad2b C T 12: 4,965,915 T547I probably damaging Het
C030005K15Rik A T 10: 97,725,786 S28T unknown Het
Cdk5rap3 A G 11: 96,908,828 L387P probably damaging Het
Clec4f T A 6: 83,652,997 N193I probably damaging Het
Col4a4 A T 1: 82,529,656 probably null Het
Cplx4 T G 18: 65,957,045 D101A possibly damaging Het
Cpne8 A T 15: 90,649,271 D50E probably damaging Het
Csmd3 G T 15: 47,857,920 D1542E possibly damaging Het
Ctdp1 A G 18: 80,469,521 V9A probably benign Het
Ctnnd2 A T 15: 30,332,155 probably benign Het
Cyp7b1 C T 3: 18,097,510 A180T probably benign Het
D3Ertd254e T A 3: 36,164,786 Y319* probably null Het
Dcun1d5 C T 9: 7,203,379 probably benign Het
Dgat1 G T 15: 76,502,999 L363I possibly damaging Het
Dlg1 T A 16: 31,743,147 H120Q probably benign Het
Dnah6 T C 6: 73,124,757 N1928S probably benign Het
Ednra T G 8: 77,720,020 probably benign Het
Efcab6 A T 15: 83,918,292 C845S probably benign Het
Egln1 A T 8: 124,915,696 C303S probably damaging Het
Eomes T C 9: 118,482,300 probably null Het
Epha1 A G 6: 42,363,822 V568A probably benign Het
Ercc6 T A 14: 32,517,028 N24K probably benign Het
Esco2 T C 14: 65,827,277 Q338R probably benign Het
Fbxo46 T C 7: 19,135,729 V91A probably damaging Het
Fryl A T 5: 73,041,332 probably benign Het
Gab3 A C X: 75,033,418 D43E probably damaging Het
Gltpd2 T A 11: 70,519,709 probably benign Het
Gm17333 G T 16: 77,852,823 noncoding transcript Het
Gm7353 T C 7: 3,110,570 noncoding transcript Het
Grik4 T C 9: 42,688,109 probably benign Het
Gtpbp2 G T 17: 46,165,969 A358S possibly damaging Het
Hyls1 C T 9: 35,561,232 C296Y probably damaging Het
Igf2r C T 17: 12,692,101 M1943I probably benign Het
Ireb2 T A 9: 54,896,577 N517K probably damaging Het
Itga10 A G 3: 96,653,660 S614G possibly damaging Het
Kdm2b A G 5: 122,984,460 probably null Het
Kif17 T C 4: 138,298,231 M948T possibly damaging Het
Klhl33 A T 14: 50,892,126 N347K probably damaging Het
Llph T A 10: 120,228,181 C67* probably null Het
Lrrn3 T C 12: 41,454,034 T95A probably damaging Het
Map3k12 C A 15: 102,502,178 A455S probably damaging Het
Mex3d T C 10: 80,381,542 T149A probably benign Het
Myo7b A G 18: 32,000,070 W409R probably damaging Het
Nbea A G 3: 56,009,340 M833T possibly damaging Het
Ncapg A G 5: 45,679,894 T436A probably null Het
Nkx1-2 C A 7: 132,599,313 D72Y probably null Het
Olfr1532-ps1 T A 7: 106,915,110 I304K probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Olfr815 T A 10: 129,901,882 N276I probably damaging Het
Pcdh15 A G 10: 74,624,255 Y1308C probably damaging Het
Pcnx2 A G 8: 125,886,926 probably benign Het
Pcsk1 G A 13: 75,097,977 G158D probably damaging Het
Phkb A T 8: 86,017,441 D573V probably damaging Het
Pik3r4 A G 9: 105,667,771 K150E possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Ppp4r4 C T 12: 103,600,495 A67V probably damaging Het
Prex2 A G 1: 11,181,898 T1056A probably benign Het
Prkca A T 11: 108,012,692 Y285N possibly damaging Het
Psd T C 19: 46,313,441 E903G probably damaging Het
Psg19 T C 7: 18,794,062 E252G probably benign Het
Psg20 T A 7: 18,681,044 K306* probably null Het
Pygl T G 12: 70,194,374 probably benign Het
Rasgrf2 A G 13: 91,982,771 S724P probably damaging Het
Reck C A 4: 43,922,967 A414D probably damaging Het
Scn10a C A 9: 119,630,147 V1150L probably damaging Het
Shc2 A T 10: 79,629,917 I187N probably damaging Het
Sipa1l3 T A 7: 29,387,291 K625* probably null Het
Slc44a4 T C 17: 34,928,490 L583P possibly damaging Het
Slc5a11 G C 7: 123,258,420 R244P possibly damaging Het
Slfn8 T A 11: 83,003,581 Q744L probably benign Het
Snx2 G T 18: 53,176,416 V13L probably benign Het
Spsb1 C T 4: 149,906,415 probably null Het
Stfa2l1 A T 16: 36,156,858 I8L probably benign Het
Svil G T 18: 5,097,494 R1659L probably damaging Het
Tbccd1 A T 16: 22,822,245 L461M probably benign Het
Tmem9 A T 1: 136,034,188 T174S possibly damaging Het
Tnks2 T C 19: 36,890,050 probably null Het
Tnrc18 C A 5: 142,815,114 V30L probably benign Het
Tomm7 A G 5: 23,844,027 F16S probably damaging Het
Ttf2 A G 3: 100,969,549 probably benign Het
Ubr7 C A 12: 102,769,191 T303N probably damaging Het
Ushbp1 A T 8: 71,390,224 probably null Het
Vmn1r177 C A 7: 23,866,050 V134F probably benign Het
Vmn2r12 A G 5: 109,087,850 probably null Het
Vmn2r53 T G 7: 12,601,214 H173P probably benign Het
Wdr78 T C 4: 103,049,386 probably benign Het
Yars A T 4: 129,197,155 M119L probably damaging Het
Zcrb1 A T 15: 93,397,157 probably benign Het
Zfp319 C A 8: 95,329,622 probably benign Het
Zfp783 C G 6: 47,943,386 noncoding transcript Het
Zfyve26 A G 12: 79,273,598 I1024T possibly damaging Het
Other mutations in Dync2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dync2h1 APN 9 7158839 missense probably benign 0.42
IGL00310:Dync2h1 APN 9 7155072 splice site probably benign
IGL00499:Dync2h1 APN 9 7168700 missense possibly damaging 0.95
IGL00579:Dync2h1 APN 9 7035728 splice site probably benign
IGL00660:Dync2h1 APN 9 7075797 missense probably damaging 0.98
IGL00964:Dync2h1 APN 9 7174881 splice site probably benign
IGL01025:Dync2h1 APN 9 7162789 missense probably damaging 1.00
IGL01093:Dync2h1 APN 9 7145611 missense probably benign 0.01
IGL01108:Dync2h1 APN 9 7176771 missense possibly damaging 0.87
IGL01126:Dync2h1 APN 9 7116588 missense probably benign 0.00
IGL01474:Dync2h1 APN 9 7102493 missense probably benign 0.01
IGL01531:Dync2h1 APN 9 7071111 missense probably benign 0.11
IGL01548:Dync2h1 APN 9 7071922 missense probably damaging 1.00
IGL01621:Dync2h1 APN 9 7140897 critical splice donor site probably null
IGL01672:Dync2h1 APN 9 7118884 nonsense probably null
IGL01681:Dync2h1 APN 9 7142196 splice site probably null
IGL01685:Dync2h1 APN 9 7142297 missense probably damaging 1.00
IGL01724:Dync2h1 APN 9 7081077 missense probably benign 0.03
IGL01738:Dync2h1 APN 9 7114922 missense possibly damaging 0.77
IGL01783:Dync2h1 APN 9 7118822 unclassified probably benign
IGL01813:Dync2h1 APN 9 7122799 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7114973 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7011207 missense probably benign 0.33
IGL02105:Dync2h1 APN 9 7075892 missense probably damaging 1.00
IGL02137:Dync2h1 APN 9 7134349 missense probably benign
IGL02140:Dync2h1 APN 9 7147791 missense probably benign
IGL02175:Dync2h1 APN 9 7111548 missense possibly damaging 0.91
IGL02283:Dync2h1 APN 9 7125912 missense probably damaging 0.99
IGL02305:Dync2h1 APN 9 7122678 missense probably benign
IGL02342:Dync2h1 APN 9 7142246 missense probably damaging 1.00
IGL02367:Dync2h1 APN 9 7158926 missense probably damaging 0.98
IGL02458:Dync2h1 APN 9 7117422 missense probably damaging 1.00
IGL02563:Dync2h1 APN 9 7035700 missense possibly damaging 0.95
IGL02825:Dync2h1 APN 9 6955901 splice site probably benign
IGL02955:Dync2h1 APN 9 7142864 missense probably benign 0.00
IGL02992:Dync2h1 APN 9 7137074 missense probably benign 0.01
IGL02996:Dync2h1 APN 9 6935279 missense probably damaging 0.99
IGL03224:Dync2h1 APN 9 7076235 missense probably benign 0.32
IGL03226:Dync2h1 APN 9 7125918 missense probably benign
IGL03233:Dync2h1 APN 9 7101525 missense possibly damaging 0.90
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0043:Dync2h1 UTSW 9 7005574 missense probably benign 0.05
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0121:Dync2h1 UTSW 9 7001327 splice site probably benign
R0277:Dync2h1 UTSW 9 7129046 missense probably benign
R0360:Dync2h1 UTSW 9 7113182 missense possibly damaging 0.62
R0362:Dync2h1 UTSW 9 7005487 splice site probably null
R0389:Dync2h1 UTSW 9 7167244 splice site probably null
R0443:Dync2h1 UTSW 9 7167244 splice site probably null
R0496:Dync2h1 UTSW 9 7155180 missense probably benign 0.42
R0506:Dync2h1 UTSW 9 7113153 missense probably benign 0.05
R0511:Dync2h1 UTSW 9 7122692 missense probably benign 0.00
R0540:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0550:Dync2h1 UTSW 9 7120954 intron probably null
R0564:Dync2h1 UTSW 9 7139432 missense probably damaging 1.00
R0607:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0699:Dync2h1 UTSW 9 7103680 missense probably benign 0.00
R0725:Dync2h1 UTSW 9 7015497 missense possibly damaging 0.93
R0835:Dync2h1 UTSW 9 7116642 critical splice acceptor site probably null
R0837:Dync2h1 UTSW 9 7077979 missense probably benign 0.07
R0938:Dync2h1 UTSW 9 7002658 missense probably benign 0.02
R1056:Dync2h1 UTSW 9 7147731 missense probably benign 0.15
R1081:Dync2h1 UTSW 9 7005488 critical splice donor site probably null
R1178:Dync2h1 UTSW 9 7101193 splice site probably benign
R1243:Dync2h1 UTSW 9 7120882 missense probably benign
R1295:Dync2h1 UTSW 9 7075752 splice site probably benign
R1304:Dync2h1 UTSW 9 7102318 missense probably damaging 1.00
R1387:Dync2h1 UTSW 9 7125816 missense probably benign
R1513:Dync2h1 UTSW 9 7103663 missense possibly damaging 0.74
R1557:Dync2h1 UTSW 9 7140911 missense probably damaging 1.00
R1568:Dync2h1 UTSW 9 7157553 missense probably null 0.02
R1570:Dync2h1 UTSW 9 7176926 missense probably benign 0.12
R1670:Dync2h1 UTSW 9 6993942 missense possibly damaging 0.82
R1713:Dync2h1 UTSW 9 7131891 missense probably benign
R1766:Dync2h1 UTSW 9 7015526 critical splice acceptor site probably null
R1773:Dync2h1 UTSW 9 7128256 missense probably damaging 1.00
R1786:Dync2h1 UTSW 9 7081084 missense probably damaging 1.00
R1848:Dync2h1 UTSW 9 7049166 missense probably benign 0.01
R1850:Dync2h1 UTSW 9 7001448 missense probably benign 0.00
R1935:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1936:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1937:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1939:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1940:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1944:Dync2h1 UTSW 9 7001377 missense probably damaging 1.00
R1976:Dync2h1 UTSW 9 7129045 missense probably benign
R2012:Dync2h1 UTSW 9 7169589 missense probably benign 0.00
R2020:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2020:Dync2h1 UTSW 9 7162925 missense probably benign 0.25
R2024:Dync2h1 UTSW 9 7129062 missense probably damaging 0.97
R2038:Dync2h1 UTSW 9 6967226 missense probably damaging 0.99
R2045:Dync2h1 UTSW 9 7160171 missense probably damaging 1.00
R2060:Dync2h1 UTSW 9 7162802 missense possibly damaging 0.92
R2094:Dync2h1 UTSW 9 7148735 missense probably benign 0.18
R2129:Dync2h1 UTSW 9 7175289 missense possibly damaging 0.94
R2130:Dync2h1 UTSW 9 7011253 missense probably damaging 1.00
R2136:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2164:Dync2h1 UTSW 9 7124797 missense probably damaging 1.00
R2242:Dync2h1 UTSW 9 7037828 splice site probably null
R2255:Dync2h1 UTSW 9 6955905 critical splice donor site probably null
R2357:Dync2h1 UTSW 9 7081053 missense probably benign 0.03
R2389:Dync2h1 UTSW 9 7122618 missense possibly damaging 0.82
R2412:Dync2h1 UTSW 9 7144246 missense probably benign 0.01
R2885:Dync2h1 UTSW 9 7102329 missense probably damaging 1.00
R2909:Dync2h1 UTSW 9 7049114 missense probably damaging 1.00
R3434:Dync2h1 UTSW 9 7011236 missense probably benign
R3719:Dync2h1 UTSW 9 7006882 splice site probably benign
R3723:Dync2h1 UTSW 9 7041658 missense probably benign 0.17
R3800:Dync2h1 UTSW 9 7101525 missense possibly damaging 0.90
R3803:Dync2h1 UTSW 9 6935293 missense probably benign 0.00
R3936:Dync2h1 UTSW 9 7001482 missense probably damaging 1.00
R3941:Dync2h1 UTSW 9 7124825 missense probably benign
R3950:Dync2h1 UTSW 9 7112061 nonsense probably null
R4004:Dync2h1 UTSW 9 7117404 missense probably damaging 1.00
R4091:Dync2h1 UTSW 9 7131881 missense probably benign 0.01
R4233:Dync2h1 UTSW 9 7134360 missense probably benign 0.02
R4302:Dync2h1 UTSW 9 7077880 missense probably benign 0.02
R4451:Dync2h1 UTSW 9 6983477 missense probably benign 0.02
R4512:Dync2h1 UTSW 9 7085009 nonsense probably null
R4596:Dync2h1 UTSW 9 6992595 missense probably benign
R4604:Dync2h1 UTSW 9 7140995 missense probably benign 0.00
R4614:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R4667:Dync2h1 UTSW 9 7051411 missense probably benign 0.00
R4671:Dync2h1 UTSW 9 7169640 missense possibly damaging 0.82
R4714:Dync2h1 UTSW 9 7118932 missense possibly damaging 0.86
R4716:Dync2h1 UTSW 9 7142648 critical splice donor site probably null
R4736:Dync2h1 UTSW 9 7006862 missense probably benign 0.00
R4807:Dync2h1 UTSW 9 7139422 missense probably benign 0.31
R4850:Dync2h1 UTSW 9 7134364 missense probably benign 0.14
R4862:Dync2h1 UTSW 9 7147717 missense probably benign
R4899:Dync2h1 UTSW 9 7131921 nonsense probably null
R4971:Dync2h1 UTSW 9 7131949 missense probably benign
R5040:Dync2h1 UTSW 9 6992625 missense probably benign 0.09
R5054:Dync2h1 UTSW 9 7085007 missense possibly damaging 0.63
R5274:Dync2h1 UTSW 9 7116540 missense probably benign 0.00
R5307:Dync2h1 UTSW 9 7155099 missense probably damaging 1.00
R5347:Dync2h1 UTSW 9 7129727 missense probably damaging 1.00
R5372:Dync2h1 UTSW 9 7176962 unclassified probably benign
R5384:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5385:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5394:Dync2h1 UTSW 9 7120899 nonsense probably null
R5402:Dync2h1 UTSW 9 7114949 missense probably damaging 1.00
R5446:Dync2h1 UTSW 9 7144217 missense probably benign
R5538:Dync2h1 UTSW 9 7168630 intron probably benign
R5551:Dync2h1 UTSW 9 7031718 missense possibly damaging 0.74
R5619:Dync2h1 UTSW 9 7118885 missense probably benign 0.02
R5621:Dync2h1 UTSW 9 7120909 missense possibly damaging 0.86
R5652:Dync2h1 UTSW 9 7116638 missense probably benign 0.45
R5655:Dync2h1 UTSW 9 7148659 missense probably benign 0.01
R5689:Dync2h1 UTSW 9 7169689 missense probably damaging 1.00
R5725:Dync2h1 UTSW 9 7169528 missense probably benign 0.21
R5742:Dync2h1 UTSW 9 7165762 missense possibly damaging 0.64
R5817:Dync2h1 UTSW 9 6996905 missense probably damaging 1.00
R5852:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R5898:Dync2h1 UTSW 9 7148717 missense probably benign 0.00
R5916:Dync2h1 UTSW 9 7102309 critical splice donor site probably null
R5939:Dync2h1 UTSW 9 7037801 missense probably damaging 0.99
R5942:Dync2h1 UTSW 9 7117466 nonsense probably null
R5982:Dync2h1 UTSW 9 6955986 missense probably benign 0.00
R6029:Dync2h1 UTSW 9 7157646 missense probably benign
R6125:Dync2h1 UTSW 9 7168706 missense probably damaging 1.00
R6209:Dync2h1 UTSW 9 7165677 missense probably benign 0.01
R6247:Dync2h1 UTSW 9 7135078 missense probably damaging 1.00
R6294:Dync2h1 UTSW 9 7084986 missense probably benign 0.01
R6328:Dync2h1 UTSW 9 7165717 missense probably benign 0.00
R6376:Dync2h1 UTSW 9 7165703 missense probably benign 0.21
R6394:Dync2h1 UTSW 9 7168331 missense probably damaging 0.99
R6539:Dync2h1 UTSW 9 7159478 splice site probably null
R6554:Dync2h1 UTSW 9 7037699 missense probably benign 0.39
R6559:Dync2h1 UTSW 9 7139501 missense possibly damaging 0.72
R6563:Dync2h1 UTSW 9 7120819 missense probably benign 0.27
R6807:Dync2h1 UTSW 9 7041718 missense probably benign 0.10
R6848:Dync2h1 UTSW 9 7159632 missense probably benign 0.22
R6901:Dync2h1 UTSW 9 7131855 missense probably damaging 1.00
R6921:Dync2h1 UTSW 9 7102549 missense probably benign
R6997:Dync2h1 UTSW 9 7168743 missense probably null 0.00
R7084:Dync2h1 UTSW 9 7113214 missense possibly damaging 0.72
R7113:Dync2h1 UTSW 9 7075788 missense probably benign 0.03
R7131:Dync2h1 UTSW 9 7075786 missense probably damaging 1.00
R7165:Dync2h1 UTSW 9 7050479 missense probably benign
R7196:Dync2h1 UTSW 9 7147715 nonsense probably null
R7208:Dync2h1 UTSW 9 7141059 missense probably damaging 1.00
R7225:Dync2h1 UTSW 9 7142756 missense probably benign
R7237:Dync2h1 UTSW 9 6993966 missense probably benign 0.00
R7243:Dync2h1 UTSW 9 7102405 missense possibly damaging 0.64
R7291:Dync2h1 UTSW 9 6929590 missense possibly damaging 0.69
R7293:Dync2h1 UTSW 9 7001454 missense possibly damaging 0.88
X0009:Dync2h1 UTSW 9 7117576 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GACACTCAAACATTTACCTTGAGCAACC -3'
(R):5'- GACTGGACACTTACGAGTTTTGAAGGAA -3'

Sequencing Primer
(F):5'- TTGAGCAACCAGATCTCGTC -3'
(R):5'- CTTACGAGTTTTGAAGGAAAAGAAG -3'
Posted On2013-11-08