Incidental Mutation 'R0900:Jag1'
ID83824
Institutional Source Beutler Lab
Gene Symbol Jag1
Ensembl Gene ENSMUSG00000027276
Gene Namejagged 1
SynonymsABE2, Gsfabe2, Serrate-1, Htu, Ozz, Headturner
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0900 (G1)
Quality Score217
Status Not validated
Chromosome2
Chromosomal Location137081456-137116644 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTTT to CTTTT at 137090882 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028735]
Predicted Effect probably null
Transcript: ENSMUST00000028735
SMART Domains Protein: ENSMUSP00000028735
Gene: ENSMUSG00000027276

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:MNNL 31 109 2.8e-31 PFAM
DSL 167 229 1.85e-37 SMART
EGF 233 263 1.66e1 SMART
EGF 264 294 2.25e1 SMART
EGF_CA 296 334 4.42e-7 SMART
EGF 339 372 2.64e-5 SMART
EGF_CA 374 410 2.89e-11 SMART
EGF_CA 412 448 2.8e-9 SMART
EGF_CA 450 485 2.31e-10 SMART
EGF_CA 487 523 1.69e-12 SMART
EGF_CA 525 561 4.19e-8 SMART
EGF 577 627 2.16e-1 SMART
EGF_CA 629 665 2.56e-12 SMART
EGF_CA 667 703 6.91e-9 SMART
EGF 708 741 5.88e-3 SMART
EGF 747 780 9.62e-8 SMART
EGF_CA 782 818 3.59e-7 SMART
EGF_CA 820 856 3.81e-11 SMART
VWC 863 930 4.79e-16 SMART
transmembrane domain 1069 1091 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133640
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The jagged 1 protein encoded by JAG1 is the human homolog of the Drosophilia jagged protein. Human jagged 1 is the ligand for the receptor notch 1, the latter a human homolog of the Drosophilia jagged receptor notch. Mutations that alter the jagged 1 protein cause Alagille syndrome. Jagged 1 signalling through notch 1 has also been shown to play a role in hematopoiesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit extensive hemorrhaging and die prior to embryonic day 11.5, while heterozygotes exhibit defects of the eye. Heterozygotes for missense mutations have inner ear abnormalities. Other mutant mice display abnormal head movements. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,940,624 F144I probably damaging Het
Als2cl A G 9: 110,890,428 R468G possibly damaging Het
Arsk C A 13: 76,098,457 probably benign Het
Cacna1d T C 14: 30,111,082 H912R probably damaging Het
Ccr1 A T 9: 123,964,334 V53D possibly damaging Het
Clec2d G A 6: 129,183,113 R30K probably benign Het
Col12a1 A G 9: 79,684,253 V975A possibly damaging Het
Col4a1 AGCCAGGGATGCCAGG AGCCAGG 8: 11,218,014 probably benign Het
Cul7 T C 17: 46,658,337 S907P probably benign Het
Depdc1b A T 13: 108,362,260 H159L possibly damaging Het
Dhx57 T C 17: 80,275,582 H198R probably benign Het
Dpp7 T C 2: 25,356,299 D10G probably damaging Het
Esp18 G A 17: 39,408,132 M7I possibly damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fam167a A G 14: 63,452,379 T42A probably damaging Het
Gm973 A G 1: 59,566,668 R553G probably benign Het
Ift140 T A 17: 25,035,812 I422N probably benign Het
Limk2 A G 11: 3,350,731 F204L probably damaging Het
Lmo7 A G 14: 101,887,188 D361G probably damaging Het
Maats1 G A 16: 38,336,402 S47L possibly damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr589 T A 7: 103,155,313 M145L probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdh18 A T 3: 49,756,803 F21Y probably benign Het
Pcna-ps2 T A 19: 9,284,123 Y249N probably damaging Het
Prkce A T 17: 86,625,458 D622V probably damaging Het
Prss47 A C 13: 65,049,394 V176G possibly damaging Het
Prss55 C T 14: 64,077,178 R181H probably benign Het
Prtg A T 9: 72,844,943 I204L probably benign Het
Pura T C 18: 36,287,667 I169T probably damaging Het
Rttn C T 18: 89,101,691 T1750I probably benign Het
Slc25a26 T A 6: 94,507,658 S60T probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem94 T A 11: 115,791,978 C614S probably benign Het
Trim12a T C 7: 104,304,262 N214S probably benign Het
Ube3c T C 5: 29,601,346 Y329H probably benign Het
Ubxn2a T C 12: 4,902,257 K2E probably damaging Het
Unc80 A T 1: 66,671,598 E2675D probably benign Het
Usf3 C T 16: 44,215,958 P267L probably benign Het
Vmn1r129 A T 7: 21,360,710 Y194* probably null Het
Zfp750 T C 11: 121,512,981 E356G probably benign Het
Other mutations in Jag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Jag1 APN 2 137086032 critical splice acceptor site probably null
IGL00912:Jag1 APN 2 137115573 missense probably damaging 1.00
IGL01104:Jag1 APN 2 137084378 missense probably benign 0.40
IGL01529:Jag1 APN 2 137084977 missense probably damaging 0.99
IGL01578:Jag1 APN 2 137100051 splice site probably benign
IGL01720:Jag1 APN 2 137087103 missense probably damaging 1.00
IGL01809:Jag1 APN 2 137115484 missense probably damaging 1.00
IGL02402:Jag1 APN 2 137085938 missense possibly damaging 0.79
IGL02434:Jag1 APN 2 137087155 missense probably benign 0.01
IGL02543:Jag1 APN 2 137091947 splice site probably benign
IGL02650:Jag1 APN 2 137115585 missense possibly damaging 0.95
IGL03010:Jag1 APN 2 137093198 splice site probably benign
IGL03102:Jag1 APN 2 137084688 missense probably benign 0.00
Grenville UTSW 2 137087142 missense probably damaging 1.00
PIT4651001:Jag1 UTSW 2 137101697 missense probably damaging 1.00
R0227:Jag1 UTSW 2 137115618 missense probably benign
R0306:Jag1 UTSW 2 137085935 missense probably damaging 1.00
R0325:Jag1 UTSW 2 137095445 critical splice donor site probably null
R0594:Jag1 UTSW 2 137087080 missense probably damaging 0.99
R0838:Jag1 UTSW 2 137093278 missense probably damaging 0.98
R0879:Jag1 UTSW 2 137100081 missense possibly damaging 0.80
R0972:Jag1 UTSW 2 137083451 missense possibly damaging 0.64
R1083:Jag1 UTSW 2 137096232 missense probably damaging 0.99
R1182:Jag1 UTSW 2 137091489 missense probably benign 0.36
R1292:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1464:Jag1 UTSW 2 137115648 missense probably damaging 0.98
R1464:Jag1 UTSW 2 137115648 missense probably damaging 0.98
R1500:Jag1 UTSW 2 137115638 missense possibly damaging 0.82
R1936:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1937:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1939:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1998:Jag1 UTSW 2 137090938 missense probably damaging 1.00
R2019:Jag1 UTSW 2 137084679 missense probably benign 0.37
R2213:Jag1 UTSW 2 137089892 missense probably benign 0.01
R2300:Jag1 UTSW 2 137096315 missense probably damaging 1.00
R2484:Jag1 UTSW 2 137084700 missense possibly damaging 0.86
R4179:Jag1 UTSW 2 137101658 missense probably damaging 0.99
R4212:Jag1 UTSW 2 137085070 missense probably benign
R4630:Jag1 UTSW 2 137085979 missense probably damaging 1.00
R4701:Jag1 UTSW 2 137094456 missense probably benign 0.11
R4705:Jag1 UTSW 2 137096309 missense probably damaging 1.00
R4904:Jag1 UTSW 2 137087142 missense probably damaging 1.00
R5050:Jag1 UTSW 2 137085154 missense possibly damaging 0.71
R5288:Jag1 UTSW 2 137095544 missense possibly damaging 0.75
R5367:Jag1 UTSW 2 137085094 missense possibly damaging 0.90
R5385:Jag1 UTSW 2 137095544 missense possibly damaging 0.75
R5386:Jag1 UTSW 2 137095544 missense possibly damaging 0.75
R5430:Jag1 UTSW 2 137101706 missense possibly damaging 0.94
R5472:Jag1 UTSW 2 137084995 missense probably damaging 1.00
R5755:Jag1 UTSW 2 137088690 missense probably damaging 1.00
R5764:Jag1 UTSW 2 137089247 missense probably damaging 1.00
R5804:Jag1 UTSW 2 137088204 missense probably benign 0.01
R6406:Jag1 UTSW 2 137087643 missense probably damaging 1.00
R6503:Jag1 UTSW 2 137101629 missense probably damaging 1.00
R6721:Jag1 UTSW 2 137094474 missense probably benign 0.00
R6826:Jag1 UTSW 2 137116175 critical splice donor site probably null
R7055:Jag1 UTSW 2 137115489 missense probably benign 0.26
R7214:Jag1 UTSW 2 137106882 missense probably benign 0.00
Z1088:Jag1 UTSW 2 137085151 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTGCTATAGACCCCTGCTGACAG -3'
(R):5'- TGCCCAGAGAAGTGATGATGACGC -3'

Sequencing Primer
(F):5'- CACCTCTGAACTGGGATGATAAATG -3'
(R):5'- AGAAGTGATGATGACGCCTTTG -3'
Posted On2013-11-08