Incidental Mutation 'R0900:Col4a1'
ID83838
Institutional Source Beutler Lab
Gene Symbol Col4a1
Ensembl Gene ENSMUSG00000031502
Gene Namecollagen, type IV, alpha 1
SynonymsDel(8)Bru44H, Svc, Raw, Del(8)44H, Bru, Col4a-1, alpha1(IV) collagen
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0900 (G1)
Quality Score181
Status Not validated
Chromosome8
Chromosomal Location11198423-11312826 bp(-) (GRCm38)
Type of Mutationsmall deletion (3 aa in frame mutation)
DNA Base Change (assembly) AGCCAGGGATGCCAGG to AGCCAGG at 11218014 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033898] [ENSMUST00000209661] [ENSMUST00000209735]
Predicted Effect probably benign
Transcript: ENSMUST00000033898
SMART Domains Protein: ENSMUSP00000033898
Gene: ENSMUSG00000031502

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 28 43 N/A INTRINSIC
internal_repeat_2 49 89 2.1e-8 PROSPERO
Pfam:Collagen 103 163 6.1e-11 PFAM
Pfam:Collagen 167 225 7.8e-10 PFAM
low complexity region 232 248 N/A INTRINSIC
Pfam:Collagen 274 334 1.7e-11 PFAM
low complexity region 356 389 N/A INTRINSIC
low complexity region 404 426 N/A INTRINSIC
low complexity region 435 455 N/A INTRINSIC
Pfam:Collagen 472 533 7.3e-12 PFAM
Pfam:Collagen 539 597 4.8e-9 PFAM
low complexity region 600 636 N/A INTRINSIC
Pfam:Collagen 642 689 4.5e-8 PFAM
Pfam:Collagen 689 746 3.5e-8 PFAM
Pfam:Collagen 736 800 2.2e-9 PFAM
Pfam:Collagen 837 896 5.2e-11 PFAM
Pfam:Collagen 882 940 1.9e-10 PFAM
Pfam:Collagen 943 1007 1.7e-10 PFAM
Pfam:Collagen 996 1058 2e-9 PFAM
Pfam:Collagen 1057 1121 1.5e-10 PFAM
low complexity region 1133 1148 N/A INTRINSIC
Pfam:Collagen 1174 1233 8.6e-11 PFAM
low complexity region 1236 1266 N/A INTRINSIC
Pfam:Collagen 1269 1337 1e-8 PFAM
Pfam:Collagen 1290 1354 2.2e-9 PFAM
Pfam:Collagen 1384 1443 1e-10 PFAM
C4 1445 1554 3.49e-65 SMART
C4 1555 1668 1.53e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130488
Predicted Effect probably benign
Transcript: ENSMUST00000209661
Predicted Effect probably benign
Transcript: ENSMUST00000209735
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the type IV collagens, an essential component of basement membranes. The encoded protein forms a triple helical heterotrimer comprised of two alpha-1 and one alpha-2 subunits that assembles into a type IV collagen network. This gene is located adjacent to the gene encoding alpha-2 subunit. Mice lacking both the alpha-1 and alpha-2 subunits of collagen IV die in utero due to structural deficiencies in the basement membranes and certain mutations in this gene cause perinatal cerebral hemorrhage and porencephaly. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice with ENU induced alleles have various eye and vision defects and may show bruising at birth. Mice carrying the G498V mutation have renal glomerular defects that resolve within the first weeks of life, but show retinal tortuosity, muscular dystrophy, brain hemorrhages, and renal cysts as adults. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,940,624 F144I probably damaging Het
Als2cl A G 9: 110,890,428 R468G possibly damaging Het
Arsk C A 13: 76,098,457 probably benign Het
Cacna1d T C 14: 30,111,082 H912R probably damaging Het
Ccr1 A T 9: 123,964,334 V53D possibly damaging Het
Clec2d G A 6: 129,183,113 R30K probably benign Het
Col12a1 A G 9: 79,684,253 V975A possibly damaging Het
Cul7 T C 17: 46,658,337 S907P probably benign Het
Depdc1b A T 13: 108,362,260 H159L possibly damaging Het
Dhx57 T C 17: 80,275,582 H198R probably benign Het
Dpp7 T C 2: 25,356,299 D10G probably damaging Het
Esp18 G A 17: 39,408,132 M7I possibly damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fam167a A G 14: 63,452,379 T42A probably damaging Het
Gm973 A G 1: 59,566,668 R553G probably benign Het
Ift140 T A 17: 25,035,812 I422N probably benign Het
Jag1 CTTT CTTTT 2: 137,090,882 probably null Het
Limk2 A G 11: 3,350,731 F204L probably damaging Het
Lmo7 A G 14: 101,887,188 D361G probably damaging Het
Maats1 G A 16: 38,336,402 S47L possibly damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr589 T A 7: 103,155,313 M145L probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdh18 A T 3: 49,756,803 F21Y probably benign Het
Pcna-ps2 T A 19: 9,284,123 Y249N probably damaging Het
Prkce A T 17: 86,625,458 D622V probably damaging Het
Prss47 A C 13: 65,049,394 V176G possibly damaging Het
Prss55 C T 14: 64,077,178 R181H probably benign Het
Prtg A T 9: 72,844,943 I204L probably benign Het
Pura T C 18: 36,287,667 I169T probably damaging Het
Rttn C T 18: 89,101,691 T1750I probably benign Het
Slc25a26 T A 6: 94,507,658 S60T probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem94 T A 11: 115,791,978 C614S probably benign Het
Trim12a T C 7: 104,304,262 N214S probably benign Het
Ube3c T C 5: 29,601,346 Y329H probably benign Het
Ubxn2a T C 12: 4,902,257 K2E probably damaging Het
Unc80 A T 1: 66,671,598 E2675D probably benign Het
Usf3 C T 16: 44,215,958 P267L probably benign Het
Vmn1r129 A T 7: 21,360,710 Y194* probably null Het
Zfp750 T C 11: 121,512,981 E356G probably benign Het
Other mutations in Col4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Col4a1 APN 8 11240077 splice site probably benign
IGL00503:Col4a1 APN 8 11240076 splice site probably benign
IGL00938:Col4a1 APN 8 11236456 intron probably benign
IGL01295:Col4a1 APN 8 11236075 intron probably benign
IGL01406:Col4a1 APN 8 11218898 missense probably damaging 1.00
IGL01807:Col4a1 APN 8 11247056 utr 5 prime probably benign
IGL01865:Col4a1 APN 8 11201790 utr 3 prime probably benign
IGL02166:Col4a1 APN 8 11244509 unclassified probably benign
IGL02234:Col4a1 APN 8 11216713 missense probably damaging 1.00
IGL02445:Col4a1 APN 8 11233911 intron probably benign
IGL02719:Col4a1 APN 8 11231950 intron probably benign
IGL02817:Col4a1 APN 8 11220259 missense probably damaging 1.00
IGL02821:Col4a1 APN 8 11221375 missense probably benign 0.04
IGL02870:Col4a1 APN 8 11221375 missense probably benign 0.04
IGL02935:Col4a1 APN 8 11219166 missense probably damaging 1.00
IGL03085:Col4a1 APN 8 11222198 nonsense probably null
Wayne UTSW 8 11209650 missense probably damaging 1.00
IGL03134:Col4a1 UTSW 8 11240069 critical splice acceptor site probably null
R0076:Col4a1 UTSW 8 11218713 missense probably damaging 1.00
R0076:Col4a1 UTSW 8 11218713 missense probably damaging 1.00
R0238:Col4a1 UTSW 8 11218780 splice site probably benign
R0239:Col4a1 UTSW 8 11218780 splice site probably benign
R0268:Col4a1 UTSW 8 11267588 splice site probably benign
R0320:Col4a1 UTSW 8 11242782 splice site probably null
R0402:Col4a1 UTSW 8 11199838 utr 3 prime probably benign
R0483:Col4a1 UTSW 8 11236423 splice site probably benign
R0511:Col4a1 UTSW 8 11208333 critical splice acceptor site probably null
R0544:Col4a1 UTSW 8 11226487 intron probably benign
R0630:Col4a1 UTSW 8 11199889 splice site probably benign
R0648:Col4a1 UTSW 8 11246892 missense unknown
R0733:Col4a1 UTSW 8 11218934 missense possibly damaging 0.46
R0839:Col4a1 UTSW 8 11221015 missense probably damaging 0.96
R0941:Col4a1 UTSW 8 11208296 missense unknown
R1456:Col4a1 UTSW 8 11242829 splice site probably benign
R1728:Col4a1 UTSW 8 11212712 missense possibly damaging 0.81
R1832:Col4a1 UTSW 8 11214644 splice site probably benign
R1862:Col4a1 UTSW 8 11226439 intron probably benign
R1955:Col4a1 UTSW 8 11208228 splice site probably null
R2058:Col4a1 UTSW 8 11210792 missense probably damaging 0.96
R2263:Col4a1 UTSW 8 11312586 unclassified probably benign
R2696:Col4a1 UTSW 8 11235092 splice site probably null
R3826:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3828:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3829:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3830:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3923:Col4a1 UTSW 8 11201665 utr 3 prime probably benign
R3980:Col4a1 UTSW 8 11239155 intron probably benign
R4120:Col4a1 UTSW 8 11206263 missense unknown
R4152:Col4a1 UTSW 8 11217227 intron probably null
R4437:Col4a1 UTSW 8 11206387 nonsense probably null
R5237:Col4a1 UTSW 8 11245068 unclassified probably benign
R5362:Col4a1 UTSW 8 11245760 unclassified probably benign
R5488:Col4a1 UTSW 8 11312550 unclassified probably benign
R5489:Col4a1 UTSW 8 11312550 unclassified probably benign
R5864:Col4a1 UTSW 8 11202973 utr 3 prime probably benign
R5929:Col4a1 UTSW 8 11216788 missense probably benign 0.17
R6159:Col4a1 UTSW 8 11220007 missense probably damaging 1.00
R6261:Col4a1 UTSW 8 11207409 splice site probably null
R6404:Col4a1 UTSW 8 11207409 splice site probably null
R6520:Col4a1 UTSW 8 11219152 missense probably damaging 1.00
R6862:Col4a1 UTSW 8 11202926 utr 3 prime probably benign
R6974:Col4a1 UTSW 8 11312538 unclassified probably benign
R7329:Col4a1 UTSW 8 11226494 critical splice acceptor site probably null
Z1088:Col4a1 UTSW 8 11246859 splice site probably benign
Predicted Primers PCR Primer
(F):5'- AAGACATTCTCTCCATCTGCCAAGC -3'
(R):5'- GAATCTTCACACTGCCTCACAGTCC -3'

Sequencing Primer
(F):5'- TGTGATATGCGGCCACC -3'
(R):5'- TCACAGTCCTCGGAACTGATG -3'
Posted On2013-11-08