Incidental Mutation 'R0900:Usf3'
ID83862
Institutional Source Beutler Lab
Gene Symbol Usf3
Ensembl Gene ENSMUSG00000068284
Gene Nameupstream transcription factor family member 3
SynonymsLOC207806, Gm608, LOC385650, 5530400K22Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock #R0900 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location44173246-44227465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44215958 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 267 (P267L)
Ref Sequence ENSEMBL: ENSMUSP00000128627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088356] [ENSMUST00000119746] [ENSMUST00000169582]
Predicted Effect probably benign
Transcript: ENSMUST00000088356
SMART Domains Protein: ENSMUSP00000085694
Gene: ENSMUSG00000068284

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119746
AA Change: P267L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112620
Gene: ENSMUSG00000068284
AA Change: P267L

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
low complexity region 151 162 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 571 587 N/A INTRINSIC
low complexity region 765 782 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
low complexity region 1084 1100 N/A INTRINSIC
low complexity region 1370 1382 N/A INTRINSIC
low complexity region 1419 1437 N/A INTRINSIC
low complexity region 1527 1555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141015
Predicted Effect probably benign
Transcript: ENSMUST00000169582
AA Change: P267L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128627
Gene: ENSMUSG00000068284
AA Change: P267L

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
low complexity region 151 162 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 571 587 N/A INTRINSIC
low complexity region 765 782 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
low complexity region 1084 1100 N/A INTRINSIC
low complexity region 1370 1382 N/A INTRINSIC
low complexity region 1419 1437 N/A INTRINSIC
low complexity region 1527 1555 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,940,624 F144I probably damaging Het
Als2cl A G 9: 110,890,428 R468G possibly damaging Het
Arsk C A 13: 76,098,457 probably benign Het
Cacna1d T C 14: 30,111,082 H912R probably damaging Het
Ccr1 A T 9: 123,964,334 V53D possibly damaging Het
Clec2d G A 6: 129,183,113 R30K probably benign Het
Col12a1 A G 9: 79,684,253 V975A possibly damaging Het
Col4a1 AGCCAGGGATGCCAGG AGCCAGG 8: 11,218,014 probably benign Het
Cul7 T C 17: 46,658,337 S907P probably benign Het
Depdc1b A T 13: 108,362,260 H159L possibly damaging Het
Dhx57 T C 17: 80,275,582 H198R probably benign Het
Dpp7 T C 2: 25,356,299 D10G probably damaging Het
Esp18 G A 17: 39,408,132 M7I possibly damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fam167a A G 14: 63,452,379 T42A probably damaging Het
Gm973 A G 1: 59,566,668 R553G probably benign Het
Ift140 T A 17: 25,035,812 I422N probably benign Het
Jag1 CTTT CTTTT 2: 137,090,882 probably null Het
Limk2 A G 11: 3,350,731 F204L probably damaging Het
Lmo7 A G 14: 101,887,188 D361G probably damaging Het
Maats1 G A 16: 38,336,402 S47L possibly damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr589 T A 7: 103,155,313 M145L probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdh18 A T 3: 49,756,803 F21Y probably benign Het
Pcna-ps2 T A 19: 9,284,123 Y249N probably damaging Het
Prkce A T 17: 86,625,458 D622V probably damaging Het
Prss47 A C 13: 65,049,394 V176G possibly damaging Het
Prss55 C T 14: 64,077,178 R181H probably benign Het
Prtg A T 9: 72,844,943 I204L probably benign Het
Pura T C 18: 36,287,667 I169T probably damaging Het
Rttn C T 18: 89,101,691 T1750I probably benign Het
Slc25a26 T A 6: 94,507,658 S60T probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem94 T A 11: 115,791,978 C614S probably benign Het
Trim12a T C 7: 104,304,262 N214S probably benign Het
Ube3c T C 5: 29,601,346 Y329H probably benign Het
Ubxn2a T C 12: 4,902,257 K2E probably damaging Het
Unc80 A T 1: 66,671,598 E2675D probably benign Het
Vmn1r129 A T 7: 21,360,710 Y194* probably null Het
Zfp750 T C 11: 121,512,981 E356G probably benign Het
Other mutations in Usf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Usf3 APN 16 44212637 splice site probably null
IGL01971:Usf3 APN 16 44217446 unclassified probably null
IGL01982:Usf3 APN 16 44218817 missense possibly damaging 0.89
IGL02124:Usf3 APN 16 44219656 missense possibly damaging 0.82
IGL02309:Usf3 APN 16 44200663 missense probably benign 0.20
IGL02454:Usf3 APN 16 44217182 missense probably damaging 1.00
IGL02526:Usf3 APN 16 44220311 missense possibly damaging 0.89
IGL02671:Usf3 APN 16 44221781 missense probably damaging 1.00
IGL02800:Usf3 APN 16 44219096 missense probably benign 0.00
IGL02899:Usf3 APN 16 44221226 missense probably damaging 1.00
IGL03223:Usf3 APN 16 44216450 missense probably damaging 1.00
I1329:Usf3 UTSW 16 44220530 missense probably damaging 1.00
R0208:Usf3 UTSW 16 44216906 missense probably damaging 0.98
R1160:Usf3 UTSW 16 44218547 missense probably damaging 1.00
R1417:Usf3 UTSW 16 44217449 missense probably benign 0.00
R1512:Usf3 UTSW 16 44221198 missense probably damaging 1.00
R1603:Usf3 UTSW 16 44218172 missense probably benign
R1702:Usf3 UTSW 16 44219632 nonsense probably null
R1774:Usf3 UTSW 16 44215670 missense probably damaging 1.00
R2344:Usf3 UTSW 16 44216051 missense probably benign
R2400:Usf3 UTSW 16 44215747 missense probably benign 0.04
R2484:Usf3 UTSW 16 44220682 missense probably damaging 0.99
R2570:Usf3 UTSW 16 44216381 missense probably benign 0.00
R3730:Usf3 UTSW 16 44218575 missense probably benign 0.00
R4024:Usf3 UTSW 16 44216165 missense possibly damaging 0.76
R4451:Usf3 UTSW 16 44217888 missense possibly damaging 0.76
R4883:Usf3 UTSW 16 44219579 missense probably damaging 1.00
R4895:Usf3 UTSW 16 44221096 missense possibly damaging 0.93
R4924:Usf3 UTSW 16 44217355 missense probably benign
R5020:Usf3 UTSW 16 44215526 missense probably damaging 1.00
R5034:Usf3 UTSW 16 44216399 missense probably damaging 1.00
R5053:Usf3 UTSW 16 44217187 missense probably benign 0.01
R5058:Usf3 UTSW 16 44212707 missense probably damaging 1.00
R5164:Usf3 UTSW 16 44218180 missense probably damaging 1.00
R5391:Usf3 UTSW 16 44217463 missense probably benign 0.01
R5407:Usf3 UTSW 16 44217406 missense probably benign 0.01
R5536:Usf3 UTSW 16 44217370 missense probably benign 0.16
R5805:Usf3 UTSW 16 44220746 missense possibly damaging 0.50
R5966:Usf3 UTSW 16 44220859 missense probably benign 0.14
R6024:Usf3 UTSW 16 44219840 missense probably damaging 1.00
R6122:Usf3 UTSW 16 44217307 missense probably damaging 0.99
R6180:Usf3 UTSW 16 44221105 missense probably damaging 1.00
R6362:Usf3 UTSW 16 44218577 missense probably benign 0.01
R6579:Usf3 UTSW 16 44218834 missense possibly damaging 0.54
R6874:Usf3 UTSW 16 44219740 missense probably benign 0.00
R7226:Usf3 UTSW 16 44220005 missense possibly damaging 0.54
X0057:Usf3 UTSW 16 44220784 missense probably benign 0.32
X0066:Usf3 UTSW 16 44220427 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGTTTATTCCAACGGGAGCCAGC -3'
(R):5'- AATCTGCACTGGAGCCCTGCATTG -3'

Sequencing Primer
(F):5'- AACCTTTAATGTTGGTCACGGC -3'
(R):5'- ATTGCCGGGCTGGACTTG -3'
Posted On2013-11-08