Incidental Mutation 'R0967:Mos'
ID83896
Institutional Source Beutler Lab
Gene Symbol Mos
Ensembl Gene ENSMUSG00000078365
Gene NameMoloney sarcoma oncogene
Synonymsc-mos
MMRRC Submission 039096-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0967 (G1)
Quality Score182
Status Validated
Chromosome4
Chromosomal Location3870657-3872105 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3870932 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 295 (S295P)
Ref Sequence ENSEMBL: ENSMUSP00000100789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105158]
Predicted Effect probably benign
Transcript: ENSMUST00000105158
AA Change: S295P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100789
Gene: ENSMUSG00000078365
AA Change: S295P

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
Pfam:Pkinase_Tyr 63 335 9e-41 PFAM
Pfam:Pkinase 64 334 6.3e-43 PFAM
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MOS is a serine/threonine kinase that activates the MAP kinase cascade through direct phosphorylation of the MAP kinase activator MEK (MAP2K1; MIM 176872) (Prasad et al., 2008 [PubMed 18246541]).[supplied by OMIM, Jul 2009]
PHENOTYPE: Mutations that inactivate the gene result in female infertility and an increased susceptibility to tumors. Oocytes progress through meiosis II without arrest and undergo spontaneous parthenogenetic activation. Male mice are fertile and show no spermatogenic defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,972,740 E736* probably null Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Camk1g T C 1: 193,350,296 E269G probably damaging Het
Ccrl2 G A 9: 111,055,686 T248M probably benign Het
Chd9 T C 8: 90,989,479 S421P probably damaging Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csmd3 T C 15: 47,857,831 E1468G probably null Het
Cyc1 T C 15: 76,345,648 probably benign Het
Fli1 T A 9: 32,461,449 T98S probably benign Het
Gk2 T C 5: 97,456,296 S228G probably benign Het
Gse1 T A 8: 120,570,855 probably benign Het
Hgf T A 5: 16,593,841 probably benign Het
Hif1a G A 12: 73,937,670 V300I possibly damaging Het
Hsd17b4 C A 18: 50,183,261 H652N probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kif5c T A 2: 49,698,116 probably benign Het
Lgr6 T C 1: 134,994,012 Y198C probably damaging Het
Lpcat2b T A 5: 107,434,218 M471K possibly damaging Het
Med21 A G 6: 146,650,199 E116G probably benign Het
Ms4a15 A T 19: 10,979,321 V209E probably damaging Het
Mttp A G 3: 138,092,723 V804A probably benign Het
Olfr205 T A 16: 59,329,183 T109S possibly damaging Het
Olfr503 T C 7: 108,544,789 I86T probably damaging Het
Olfr718-ps1 A G 5: 143,137,839 M121T probably damaging Het
Plagl1 T C 10: 13,128,242 probably benign Het
Prpf8 T A 11: 75,494,430 V797E probably damaging Het
Rars2 A G 4: 34,646,587 D284G probably benign Het
Rassf8 T C 6: 145,819,950 probably benign Het
Rfx3 A G 19: 27,806,351 probably benign Het
Ripk4 A T 16: 97,744,172 M362K probably damaging Het
Rsg1 T C 4: 141,219,851 M181T probably benign Het
Rubcn C A 16: 32,825,717 E815D probably benign Het
Scn8a A G 15: 101,035,646 Y1577C probably damaging Het
Sec24b C T 3: 129,996,782 R698Q probably damaging Het
Ssc5d T A 7: 4,944,343 L1232* probably null Het
Usp7 A T 16: 8,696,654 probably benign Het
Vmn2r51 T G 7: 10,100,085 H342P probably damaging Het
Vmn2r70 A G 7: 85,559,619 M550T probably damaging Het
Vmn2r81 T C 10: 79,248,023 probably benign Het
Zc3h13 T C 14: 75,343,739 I1722T possibly damaging Het
Other mutations in Mos
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Mos APN 4 3871459 missense probably damaging 1.00
IGL01302:Mos APN 4 3871815 utr 5 prime probably benign
IGL01739:Mos APN 4 3871816 utr 5 prime probably benign
IGL01867:Mos APN 4 3870845 missense probably benign 0.33
IGL02647:Mos APN 4 3870961 missense probably damaging 1.00
PIT4418001:Mos UTSW 4 3870814 missense possibly damaging 0.86
R4927:Mos UTSW 4 3871093 missense probably damaging 1.00
R5729:Mos UTSW 4 3870971 missense probably benign 0.01
R6947:Mos UTSW 4 3871585 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTACATCGGCTCGATGGAGTCAG -3'
(R):5'- TCACAAAGCATTTTGCACTTGGACC -3'

Sequencing Primer
(F):5'- CTCGATGGAGTCAGCCTAGTG -3'
(R):5'- CTGAAGCCAGCGAACATTTTG -3'
Posted On2013-11-08