Incidental Mutation 'R0967:Rars2'
ID83897
Institutional Source Beutler Lab
Gene Symbol Rars2
Ensembl Gene ENSMUSG00000028292
Gene Namearginyl-tRNA synthetase 2, mitochondrial
Synonyms1500002I10Rik, Rarsl, PRO1992
MMRRC Submission 039096-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0967 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location34614957-34660167 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34646587 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 284 (D284G)
Ref Sequence ENSEMBL: ENSMUSP00000029968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029968]
Predicted Effect probably benign
Transcript: ENSMUST00000029968
AA Change: D284G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000029968
Gene: ENSMUSG00000028292
AA Change: D284G

DomainStartEndE-ValueType
Pfam:tRNA-synt_1d 110 449 1e-97 PFAM
DALR_1 463 578 3.64e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142045
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This nuclear gene encodes a protein that localizes to the mitochondria, where it catalyzes the transfer of L-arginine to its cognate tRNA, an important step in translation of mitochondrially-encoded proteins. Defects in this gene are a cause of pontocerebellar hypoplasia type 6 (PCH6). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,972,740 E736* probably null Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Camk1g T C 1: 193,350,296 E269G probably damaging Het
Ccrl2 G A 9: 111,055,686 T248M probably benign Het
Chd9 T C 8: 90,989,479 S421P probably damaging Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csmd3 T C 15: 47,857,831 E1468G probably null Het
Cyc1 T C 15: 76,345,648 probably benign Het
Fli1 T A 9: 32,461,449 T98S probably benign Het
Gk2 T C 5: 97,456,296 S228G probably benign Het
Gse1 T A 8: 120,570,855 probably benign Het
Hgf T A 5: 16,593,841 probably benign Het
Hif1a G A 12: 73,937,670 V300I possibly damaging Het
Hsd17b4 C A 18: 50,183,261 H652N probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kif5c T A 2: 49,698,116 probably benign Het
Lgr6 T C 1: 134,994,012 Y198C probably damaging Het
Lpcat2b T A 5: 107,434,218 M471K possibly damaging Het
Med21 A G 6: 146,650,199 E116G probably benign Het
Mos A G 4: 3,870,932 S295P probably benign Het
Ms4a15 A T 19: 10,979,321 V209E probably damaging Het
Mttp A G 3: 138,092,723 V804A probably benign Het
Olfr205 T A 16: 59,329,183 T109S possibly damaging Het
Olfr503 T C 7: 108,544,789 I86T probably damaging Het
Olfr718-ps1 A G 5: 143,137,839 M121T probably damaging Het
Plagl1 T C 10: 13,128,242 probably benign Het
Prpf8 T A 11: 75,494,430 V797E probably damaging Het
Rassf8 T C 6: 145,819,950 probably benign Het
Rfx3 A G 19: 27,806,351 probably benign Het
Ripk4 A T 16: 97,744,172 M362K probably damaging Het
Rsg1 T C 4: 141,219,851 M181T probably benign Het
Rubcn C A 16: 32,825,717 E815D probably benign Het
Scn8a A G 15: 101,035,646 Y1577C probably damaging Het
Sec24b C T 3: 129,996,782 R698Q probably damaging Het
Ssc5d T A 7: 4,944,343 L1232* probably null Het
Usp7 A T 16: 8,696,654 probably benign Het
Vmn2r51 T G 7: 10,100,085 H342P probably damaging Het
Vmn2r70 A G 7: 85,559,619 M550T probably damaging Het
Vmn2r81 T C 10: 79,248,023 probably benign Het
Zc3h13 T C 14: 75,343,739 I1722T possibly damaging Het
Other mutations in Rars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02121:Rars2 APN 4 34657219 missense probably damaging 1.00
IGL02143:Rars2 APN 4 34623404 splice site probably benign
IGL02378:Rars2 APN 4 34656199 missense possibly damaging 0.51
IGL03035:Rars2 APN 4 34656865 critical splice donor site probably null
IGL03148:Rars2 APN 4 34650243 missense possibly damaging 0.82
R0238:Rars2 UTSW 4 34645838 missense probably damaging 1.00
R0238:Rars2 UTSW 4 34656030 missense probably benign 0.00
R0238:Rars2 UTSW 4 34645838 missense probably damaging 1.00
R0238:Rars2 UTSW 4 34656030 missense probably benign 0.00
R0671:Rars2 UTSW 4 34630505 nonsense probably null
R2276:Rars2 UTSW 4 34656835 missense probably damaging 0.96
R3726:Rars2 UTSW 4 34645787 missense probably benign
R4642:Rars2 UTSW 4 34656229 missense probably damaging 1.00
R5144:Rars2 UTSW 4 34656793 missense probably benign 0.00
R5714:Rars2 UTSW 4 34645779 missense probably benign 0.00
R5919:Rars2 UTSW 4 34657232 missense probably damaging 0.98
R5946:Rars2 UTSW 4 34656855 missense possibly damaging 0.46
R7200:Rars2 UTSW 4 34645747 missense probably benign 0.01
X0011:Rars2 UTSW 4 34652176 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGTGACTACTATACTGAACGAACGCC -3'
(R):5'- AGACCATCCTTGCACTGCTGACTC -3'

Sequencing Primer
(F):5'- ACGAACGCCAGATACATGG -3'
(R):5'- cactgctgactcttccacc -3'
Posted On2013-11-08