Incidental Mutation 'R0967:Rsg1'
ID83898
Institutional Source Beutler Lab
Gene Symbol Rsg1
Ensembl Gene ENSMUSG00000073733
Gene NameREM2 and RAB-like small GTPase 1
SynonymsLOC279260, 6330545A04Rik
MMRRC Submission 039096-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.655) question?
Stock #R0967 (G1)
Quality Score193
Status Validated
Chromosome4
Chromosomal Location141213956-141226756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141219851 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 181 (M181T)
Ref Sequence ENSEMBL: ENSMUSP00000095422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097813]
Predicted Effect probably benign
Transcript: ENSMUST00000097813
AA Change: M181T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000095422
Gene: ENSMUSG00000073733
AA Change: M181T

DomainStartEndE-ValueType
Pfam:Roc 57 179 7.3e-9 PFAM
Pfam:Ras 57 207 4.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151475
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cardiovascular defects including persistent truncus arteriosus and atrioventricular septal defects, as well as polydactyly and micrognathia. Eye defects, hypoplastic lungs and thymus, and tracheoesophageal anomalies may be also present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,972,740 E736* probably null Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Camk1g T C 1: 193,350,296 E269G probably damaging Het
Ccrl2 G A 9: 111,055,686 T248M probably benign Het
Chd9 T C 8: 90,989,479 S421P probably damaging Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csmd3 T C 15: 47,857,831 E1468G probably null Het
Cyc1 T C 15: 76,345,648 probably benign Het
Fli1 T A 9: 32,461,449 T98S probably benign Het
Gk2 T C 5: 97,456,296 S228G probably benign Het
Gse1 T A 8: 120,570,855 probably benign Het
Hgf T A 5: 16,593,841 probably benign Het
Hif1a G A 12: 73,937,670 V300I possibly damaging Het
Hsd17b4 C A 18: 50,183,261 H652N probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kif5c T A 2: 49,698,116 probably benign Het
Lgr6 T C 1: 134,994,012 Y198C probably damaging Het
Lpcat2b T A 5: 107,434,218 M471K possibly damaging Het
Med21 A G 6: 146,650,199 E116G probably benign Het
Mos A G 4: 3,870,932 S295P probably benign Het
Ms4a15 A T 19: 10,979,321 V209E probably damaging Het
Mttp A G 3: 138,092,723 V804A probably benign Het
Olfr205 T A 16: 59,329,183 T109S possibly damaging Het
Olfr503 T C 7: 108,544,789 I86T probably damaging Het
Olfr718-ps1 A G 5: 143,137,839 M121T probably damaging Het
Plagl1 T C 10: 13,128,242 probably benign Het
Prpf8 T A 11: 75,494,430 V797E probably damaging Het
Rars2 A G 4: 34,646,587 D284G probably benign Het
Rassf8 T C 6: 145,819,950 probably benign Het
Rfx3 A G 19: 27,806,351 probably benign Het
Ripk4 A T 16: 97,744,172 M362K probably damaging Het
Rubcn C A 16: 32,825,717 E815D probably benign Het
Scn8a A G 15: 101,035,646 Y1577C probably damaging Het
Sec24b C T 3: 129,996,782 R698Q probably damaging Het
Ssc5d T A 7: 4,944,343 L1232* probably null Het
Usp7 A T 16: 8,696,654 probably benign Het
Vmn2r51 T G 7: 10,100,085 H342P probably damaging Het
Vmn2r70 A G 7: 85,559,619 M550T probably damaging Het
Vmn2r81 T C 10: 79,248,023 probably benign Het
Zc3h13 T C 14: 75,343,739 I1722T possibly damaging Het
Other mutations in Rsg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Rsg1 APN 4 141218653 missense probably benign 0.01
R0488:Rsg1 UTSW 4 141214401 missense probably benign 0.05
R1339:Rsg1 UTSW 4 141218548 missense probably damaging 1.00
R1460:Rsg1 UTSW 4 141218212 missense probably damaging 0.97
R3826:Rsg1 UTSW 4 141218589 missense probably damaging 1.00
R3828:Rsg1 UTSW 4 141218589 missense probably damaging 1.00
R3829:Rsg1 UTSW 4 141218589 missense probably damaging 1.00
R3830:Rsg1 UTSW 4 141218589 missense probably damaging 1.00
R5076:Rsg1 UTSW 4 141217385 missense probably benign 0.00
R5242:Rsg1 UTSW 4 141219847 missense probably damaging 1.00
R5527:Rsg1 UTSW 4 141219992 missense probably damaging 1.00
R5610:Rsg1 UTSW 4 141219866 missense probably benign 0.00
R5677:Rsg1 UTSW 4 141219866 missense probably benign 0.00
R6049:Rsg1 UTSW 4 141218162 missense probably benign 0.18
R6543:Rsg1 UTSW 4 141217288 missense probably benign
R7078:Rsg1 UTSW 4 141219848 missense probably benign 0.01
R7483:Rsg1 UTSW 4 141219842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGGTCCGACCCATATGTTTCC -3'
(R):5'- AGGATGTTGTCACCGTTCAGCC -3'

Sequencing Primer
(F):5'- CCATTCAAAGGGGTCTAGGATCTG -3'
(R):5'- TTCAGCCGGGAGCACTC -3'
Posted On2013-11-08