Incidental Mutation 'R0967:Med21'
ID83904
Institutional Source Beutler Lab
Gene Symbol Med21
Ensembl Gene ENSMUSG00000030291
Gene Namemediator complex subunit 21
Synonyms0610007L03Rik, Srb7, D6Ertd782e, Surb7
MMRRC Submission 039096-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0967 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location146642547-146650732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146650199 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 116 (E116G)
Ref Sequence ENSEMBL: ENSMUSP00000145512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032429] [ENSMUST00000111650] [ENSMUST00000204040]
Predicted Effect probably benign
Transcript: ENSMUST00000032429
AA Change: E116G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000032429
Gene: ENSMUSG00000030291
AA Change: E116G

DomainStartEndE-ValueType
Pfam:Med21 1 127 1.1e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000075077
Predicted Effect probably benign
Transcript: ENSMUST00000111650
SMART Domains Protein: ENSMUSP00000107277
Gene: ENSMUSG00000030291

DomainStartEndE-ValueType
Pfam:Med21 1 90 8.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134387
Predicted Effect probably benign
Transcript: ENSMUST00000204040
AA Change: E116G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000145512
Gene: ENSMUSG00000030291
AA Change: E116G

DomainStartEndE-ValueType
Pfam:Med21 1 127 1.1e-29 PFAM
Meta Mutation Damage Score 0.328 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mediator complex subunit 21 family. The encoded protein interacts with the human RNA polymerase II holoenzyme and is involved in transcriptional regulation of RNA polymerase II transcribed genes. A pseudogene of this gene is located on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die at the blastocyst stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,972,740 E736* probably null Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Camk1g T C 1: 193,350,296 E269G probably damaging Het
Ccrl2 G A 9: 111,055,686 T248M probably benign Het
Chd9 T C 8: 90,989,479 S421P probably damaging Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csmd3 T C 15: 47,857,831 E1468G probably null Het
Cyc1 T C 15: 76,345,648 probably benign Het
Fli1 T A 9: 32,461,449 T98S probably benign Het
Gk2 T C 5: 97,456,296 S228G probably benign Het
Gse1 T A 8: 120,570,855 probably benign Het
Hgf T A 5: 16,593,841 probably benign Het
Hif1a G A 12: 73,937,670 V300I possibly damaging Het
Hsd17b4 C A 18: 50,183,261 H652N probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kif5c T A 2: 49,698,116 probably benign Het
Lgr6 T C 1: 134,994,012 Y198C probably damaging Het
Lpcat2b T A 5: 107,434,218 M471K possibly damaging Het
Mos A G 4: 3,870,932 S295P probably benign Het
Ms4a15 A T 19: 10,979,321 V209E probably damaging Het
Mttp A G 3: 138,092,723 V804A probably benign Het
Olfr205 T A 16: 59,329,183 T109S possibly damaging Het
Olfr503 T C 7: 108,544,789 I86T probably damaging Het
Olfr718-ps1 A G 5: 143,137,839 M121T probably damaging Het
Plagl1 T C 10: 13,128,242 probably benign Het
Prpf8 T A 11: 75,494,430 V797E probably damaging Het
Rars2 A G 4: 34,646,587 D284G probably benign Het
Rassf8 T C 6: 145,819,950 probably benign Het
Rfx3 A G 19: 27,806,351 probably benign Het
Ripk4 A T 16: 97,744,172 M362K probably damaging Het
Rsg1 T C 4: 141,219,851 M181T probably benign Het
Rubcn C A 16: 32,825,717 E815D probably benign Het
Scn8a A G 15: 101,035,646 Y1577C probably damaging Het
Sec24b C T 3: 129,996,782 R698Q probably damaging Het
Ssc5d T A 7: 4,944,343 L1232* probably null Het
Usp7 A T 16: 8,696,654 probably benign Het
Vmn2r51 T G 7: 10,100,085 H342P probably damaging Het
Vmn2r70 A G 7: 85,559,619 M550T probably damaging Het
Vmn2r81 T C 10: 79,248,023 probably benign Het
Zc3h13 T C 14: 75,343,739 I1722T possibly damaging Het
Other mutations in Med21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02647:Med21 APN 6 146649233 missense probably benign 0.44
IGL03369:Med21 APN 6 146642645 missense probably benign 0.21
R0049:Med21 UTSW 6 146650234 missense probably damaging 0.99
R0049:Med21 UTSW 6 146650234 missense probably damaging 0.99
R2106:Med21 UTSW 6 146649212 missense probably damaging 1.00
R4403:Med21 UTSW 6 146649182 nonsense probably null
R4675:Med21 UTSW 6 146650193 missense probably damaging 0.97
R4747:Med21 UTSW 6 146649202 missense possibly damaging 0.58
R4749:Med21 UTSW 6 146650101 splice site probably null
R4855:Med21 UTSW 6 146648192 missense probably damaging 1.00
R5117:Med21 UTSW 6 146647283 intron probably benign
R5344:Med21 UTSW 6 146649185 missense probably benign 0.39
R7338:Med21 UTSW 6 146642584 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTCTTCAAGCAGTGCAAGCAGAG -3'
(R):5'- AGGGCTTACATCTGATGTGCAGC -3'

Sequencing Primer
(F):5'- CACAATGGTTGGAAAGGCATTC -3'
(R):5'- GATGTGCAGCATTCTTAATGCC -3'
Posted On2013-11-08