Incidental Mutation 'R0967:Vmn2r81'
ID83915
Institutional Source Beutler Lab
Gene Symbol Vmn2r81
Ensembl Gene ENSMUSG00000055515
Gene Namevomeronasal 2, receptor 81
SynonymsV2rf2, EC1-VR2, pheromone recepter
MMRRC Submission 039096-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0967 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location79247777-79294535 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 79248023 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020547]
Predicted Effect probably benign
Transcript: ENSMUST00000020547
SMART Domains Protein: ENSMUSP00000020547
Gene: ENSMUSG00000055515

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 79 474 7.7e-37 PFAM
Pfam:NCD3G 517 570 8.9e-21 PFAM
Pfam:7tm_3 603 838 6.1e-50 PFAM
Meta Mutation Damage Score 0.1688 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit vomeronasal sensory neuron axons that spread out diffusely over the posterior accessory olfactory bulb and extend abnormally into the anterior olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,972,740 E736* probably null Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Camk1g T C 1: 193,350,296 E269G probably damaging Het
Ccrl2 G A 9: 111,055,686 T248M probably benign Het
Chd9 T C 8: 90,989,479 S421P probably damaging Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csmd3 T C 15: 47,857,831 E1468G probably null Het
Cyc1 T C 15: 76,345,648 probably benign Het
Fli1 T A 9: 32,461,449 T98S probably benign Het
Gk2 T C 5: 97,456,296 S228G probably benign Het
Gse1 T A 8: 120,570,855 probably benign Het
Hgf T A 5: 16,593,841 probably benign Het
Hif1a G A 12: 73,937,670 V300I possibly damaging Het
Hsd17b4 C A 18: 50,183,261 H652N probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kif5c T A 2: 49,698,116 probably benign Het
Lgr6 T C 1: 134,994,012 Y198C probably damaging Het
Lpcat2b T A 5: 107,434,218 M471K possibly damaging Het
Med21 A G 6: 146,650,199 E116G probably benign Het
Mos A G 4: 3,870,932 S295P probably benign Het
Ms4a15 A T 19: 10,979,321 V209E probably damaging Het
Mttp A G 3: 138,092,723 V804A probably benign Het
Olfr205 T A 16: 59,329,183 T109S possibly damaging Het
Olfr503 T C 7: 108,544,789 I86T probably damaging Het
Olfr718-ps1 A G 5: 143,137,839 M121T probably damaging Het
Plagl1 T C 10: 13,128,242 probably benign Het
Prpf8 T A 11: 75,494,430 V797E probably damaging Het
Rars2 A G 4: 34,646,587 D284G probably benign Het
Rassf8 T C 6: 145,819,950 probably benign Het
Rfx3 A G 19: 27,806,351 probably benign Het
Ripk4 A T 16: 97,744,172 M362K probably damaging Het
Rsg1 T C 4: 141,219,851 M181T probably benign Het
Rubcn C A 16: 32,825,717 E815D probably benign Het
Scn8a A G 15: 101,035,646 Y1577C probably damaging Het
Sec24b C T 3: 129,996,782 R698Q probably damaging Het
Ssc5d T A 7: 4,944,343 L1232* probably null Het
Usp7 A T 16: 8,696,654 probably benign Het
Vmn2r51 T G 7: 10,100,085 H342P probably damaging Het
Vmn2r70 A G 7: 85,559,619 M550T probably damaging Het
Zc3h13 T C 14: 75,343,739 I1722T possibly damaging Het
Other mutations in Vmn2r81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Vmn2r81 APN 10 79247997 missense probably benign 0.20
IGL02255:Vmn2r81 APN 10 79247972 nonsense probably null
IGL02901:Vmn2r81 APN 10 79270730 missense probably damaging 0.98
R0383:Vmn2r81 UTSW 10 79293447 missense possibly damaging 0.95
R0555:Vmn2r81 UTSW 10 79293449 missense probably damaging 1.00
R0715:Vmn2r81 UTSW 10 79268600 missense probably damaging 1.00
R1438:Vmn2r81 UTSW 10 79293857 missense probably benign 0.00
R1468:Vmn2r81 UTSW 10 79293662 missense probably damaging 1.00
R1468:Vmn2r81 UTSW 10 79293662 missense probably damaging 1.00
R1589:Vmn2r81 UTSW 10 79293024 missense probably damaging 0.99
R1671:Vmn2r81 UTSW 10 79267431 missense probably benign 0.04
R1672:Vmn2r81 UTSW 10 79268278 missense probably damaging 0.99
R1728:Vmn2r81 UTSW 10 79270655 missense probably benign 0.08
R1784:Vmn2r81 UTSW 10 79270655 missense probably benign 0.08
R1931:Vmn2r81 UTSW 10 79293494 missense probably damaging 0.98
R1934:Vmn2r81 UTSW 10 79247794 start codon destroyed probably null 0.71
R1944:Vmn2r81 UTSW 10 79293737 missense probably damaging 1.00
R2102:Vmn2r81 UTSW 10 79293500 missense probably damaging 0.97
R2190:Vmn2r81 UTSW 10 79268251 missense possibly damaging 0.67
R2392:Vmn2r81 UTSW 10 79274682 missense probably damaging 1.00
R3770:Vmn2r81 UTSW 10 79270600 missense probably damaging 1.00
R4551:Vmn2r81 UTSW 10 79268407 missense possibly damaging 0.95
R4629:Vmn2r81 UTSW 10 79267442 missense probably damaging 0.99
R4691:Vmn2r81 UTSW 10 79293377 nonsense probably null
R4829:Vmn2r81 UTSW 10 79247801 missense possibly damaging 0.48
R4914:Vmn2r81 UTSW 10 79270523 missense probably null 1.00
R4996:Vmn2r81 UTSW 10 79293413 missense probably benign 0.04
R5242:Vmn2r81 UTSW 10 79293475 nonsense probably null
R5253:Vmn2r81 UTSW 10 79247986 missense probably benign 0.00
R5925:Vmn2r81 UTSW 10 79247803 missense probably damaging 1.00
R6169:Vmn2r81 UTSW 10 79268548 missense probably benign
R6270:Vmn2r81 UTSW 10 79293815 missense probably benign
R6525:Vmn2r81 UTSW 10 79293726 missense probably benign 0.11
R6813:Vmn2r81 UTSW 10 79268605 missense probably benign 0.00
R6886:Vmn2r81 UTSW 10 79268154 missense possibly damaging 0.90
R7200:Vmn2r81 UTSW 10 79270736 critical splice donor site probably null
R7350:Vmn2r81 UTSW 10 79268385 missense probably benign 0.03
X0067:Vmn2r81 UTSW 10 79293043 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGCAACTCATATCTGCCCAACTGAC -3'
(R):5'- CCTTTCTAGTACGGAACTGGCATGG -3'

Sequencing Primer
(F):5'- TATCTGCCCAACTGACACAAAATAC -3'
(R):5'- CCCTGAGTCTGAGGAATGAC -3'
Posted On2013-11-08