Incidental Mutation 'R0967:Hif1a'
ID83918
Institutional Source Beutler Lab
Gene Symbol Hif1a
Ensembl Gene ENSMUSG00000021109
Gene Namehypoxia inducible factor 1, alpha subunit
SynonymsbHLHe78, HIF1alpha, MOP1, HIF-1alpha
MMRRC Submission 039096-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0967 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location73901375-73947530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73937670 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 300 (V300I)
Ref Sequence ENSEMBL: ENSMUSP00000021530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021530] [ENSMUST00000110461] [ENSMUST00000110464]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021530
AA Change: V300I

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021530
Gene: ENSMUSG00000021109
AA Change: V300I

DomainStartEndE-ValueType
HLH 23 78 1.29e-8 SMART
PAS 87 153 1.05e-9 SMART
PAS 230 296 2.08e-8 SMART
PAC 302 345 6.85e-9 SMART
low complexity region 416 427 N/A INTRINSIC
Pfam:HIF-1 564 594 5.4e-18 PFAM
low complexity region 621 645 N/A INTRINSIC
Pfam:HIF-1a_CTAD 799 835 3.9e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110461
AA Change: V288I

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106088
Gene: ENSMUSG00000021109
AA Change: V288I

DomainStartEndE-ValueType
HLH 11 66 1.29e-8 SMART
PAS 75 141 1.05e-9 SMART
PAS 218 284 2.08e-8 SMART
PAC 290 333 6.85e-9 SMART
low complexity region 404 415 N/A INTRINSIC
Pfam:HIF-1 536 569 6e-19 PFAM
low complexity region 595 619 N/A INTRINSIC
Pfam:HIF-1a_CTAD 771 810 1.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110464
SMART Domains Protein: ENSMUSP00000106091
Gene: ENSMUSG00000021109

DomainStartEndE-ValueType
HLH 23 78 1.29e-8 SMART
PAS 87 153 1.05e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221427
Predicted Effect unknown
Transcript: ENSMUST00000221833
AA Change: V6I
Meta Mutation Damage Score 0.386 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene encodes the alpha subunit which, along with the beta subunit, forms a heterodimeric transcription factor that regulates the cellular and developmental response to reduced oxygen tension. The transcription factor has been shown to regulate genes involved in several biological processes, including erythropoiesis and angiogenesis which aid in increased delivery of oxygen to hypoxic regions. The transcription factor also plays a role in the induction of genes involved in cell proliferation and survival, energy metabolism, apoptosis, and glucose and iron metabolism. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants die during embryonic development with severe cardiovascular malformations, neural tube defects, cephalic defects, reduced somite number and increased hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,972,740 E736* probably null Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Camk1g T C 1: 193,350,296 E269G probably damaging Het
Ccrl2 G A 9: 111,055,686 T248M probably benign Het
Chd9 T C 8: 90,989,479 S421P probably damaging Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csmd3 T C 15: 47,857,831 E1468G probably null Het
Cyc1 T C 15: 76,345,648 probably benign Het
Fli1 T A 9: 32,461,449 T98S probably benign Het
Gk2 T C 5: 97,456,296 S228G probably benign Het
Gse1 T A 8: 120,570,855 probably benign Het
Hgf T A 5: 16,593,841 probably benign Het
Hsd17b4 C A 18: 50,183,261 H652N probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kif5c T A 2: 49,698,116 probably benign Het
Lgr6 T C 1: 134,994,012 Y198C probably damaging Het
Lpcat2b T A 5: 107,434,218 M471K possibly damaging Het
Med21 A G 6: 146,650,199 E116G probably benign Het
Mos A G 4: 3,870,932 S295P probably benign Het
Ms4a15 A T 19: 10,979,321 V209E probably damaging Het
Mttp A G 3: 138,092,723 V804A probably benign Het
Olfr205 T A 16: 59,329,183 T109S possibly damaging Het
Olfr503 T C 7: 108,544,789 I86T probably damaging Het
Olfr718-ps1 A G 5: 143,137,839 M121T probably damaging Het
Plagl1 T C 10: 13,128,242 probably benign Het
Prpf8 T A 11: 75,494,430 V797E probably damaging Het
Rars2 A G 4: 34,646,587 D284G probably benign Het
Rassf8 T C 6: 145,819,950 probably benign Het
Rfx3 A G 19: 27,806,351 probably benign Het
Ripk4 A T 16: 97,744,172 M362K probably damaging Het
Rsg1 T C 4: 141,219,851 M181T probably benign Het
Rubcn C A 16: 32,825,717 E815D probably benign Het
Scn8a A G 15: 101,035,646 Y1577C probably damaging Het
Sec24b C T 3: 129,996,782 R698Q probably damaging Het
Ssc5d T A 7: 4,944,343 L1232* probably null Het
Usp7 A T 16: 8,696,654 probably benign Het
Vmn2r51 T G 7: 10,100,085 H342P probably damaging Het
Vmn2r70 A G 7: 85,559,619 M550T probably damaging Het
Vmn2r81 T C 10: 79,248,023 probably benign Het
Zc3h13 T C 14: 75,343,739 I1722T possibly damaging Het
Other mutations in Hif1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Hif1a APN 12 73942010 missense probably damaging 1.00
IGL01396:Hif1a APN 12 73940533 missense probably benign 0.00
IGL02230:Hif1a APN 12 73932450 missense probably damaging 1.00
IGL02561:Hif1a APN 12 73942206 missense possibly damaging 0.52
IGL02698:Hif1a APN 12 73930771 critical splice donor site probably null
IGL03027:Hif1a APN 12 73940477 missense probably benign 0.03
lightweight UTSW 12 73941800 missense probably damaging 1.00
R0597:Hif1a UTSW 12 73942275 missense probably benign 0.00
R0614:Hif1a UTSW 12 73945631 missense probably damaging 1.00
R0678:Hif1a UTSW 12 73944191 splice site probably null
R1351:Hif1a UTSW 12 73940461 missense probably benign 0.00
R1387:Hif1a UTSW 12 73942292 missense possibly damaging 0.95
R1858:Hif1a UTSW 12 73944155 missense probably benign
R2105:Hif1a UTSW 12 73937745 missense probably damaging 1.00
R2194:Hif1a UTSW 12 73930747 missense probably damaging 0.98
R4825:Hif1a UTSW 12 73932401 missense probably damaging 1.00
R4924:Hif1a UTSW 12 73939557 missense probably damaging 1.00
R5386:Hif1a UTSW 12 73944093 missense probably benign 0.02
R5594:Hif1a UTSW 12 73937792 nonsense probably null
R5722:Hif1a UTSW 12 73941759 missense probably benign 0.00
R5818:Hif1a UTSW 12 73939564 missense possibly damaging 0.64
R5831:Hif1a UTSW 12 73942144 missense probably benign
R6026:Hif1a UTSW 12 73932281 missense probably damaging 1.00
R6059:Hif1a UTSW 12 73941800 missense probably damaging 1.00
R6084:Hif1a UTSW 12 73941842 missense probably damaging 0.99
R6818:Hif1a UTSW 12 73945563 nonsense probably null
R6878:Hif1a UTSW 12 73928281 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GTGACCATACCTCATTGAAGGAACTGC -3'
(R):5'- AAAGTGTCTCCTCCCAAGCTTACCTTA -3'

Sequencing Primer
(F):5'- cccctacctaccccgac -3'
(R):5'- AGCTTACCTTACAACATAATTCACAC -3'
Posted On2013-11-08