Incidental Mutation 'R0968:1110002E22Rik'
List |< first << previous [record 95 of 386652] next >> last >|
ID83939
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene NameRIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission 039097-MU
Accession Numbers
Stock #R0968 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138065052-138081506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 138067206 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 719 (V719M)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163080]
Predicted Effect probably damaging
Transcript: ENSMUST00000163080
AA Change: V719M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: V719M

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency 94% (34/36)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700040L02Rik T C 10: 68,436,372 M254V probably benign Het
Abca13 A G 11: 9,298,016 S2588G probably benign Het
Acaca C T 11: 84,239,033 Q405* probably null Het
Brms1l G A 12: 55,866,013 D264N possibly damaging Het
Cndp1 G A 18: 84,634,652 probably benign Het
Coro7 G C 16: 4,670,055 probably benign Het
Cylc2 A G 4: 51,216,706 M1V probably null Het
Cyp3a11 G A 5: 145,862,514 probably benign Het
Dnah10 C T 5: 124,829,577 T4224M probably damaging Het
Dnah2 T C 11: 69,448,519 E3054G possibly damaging Het
Dnm3 A G 1: 162,019,819 probably benign Het
Efcab5 G A 11: 77,140,923 R178W probably damaging Het
Fgf12 T C 16: 28,162,433 N239S probably benign Het
Flt3 C T 5: 147,341,227 V846I possibly damaging Het
Gm11569 A T 11: 99,798,424 C150S unknown Het
Gm12695 A C 4: 96,762,066 V181G probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Lars C A 18: 42,218,583 R852L probably benign Het
Lca5 T C 9: 83,423,169 T195A probably benign Het
Lrrc40 G A 3: 158,036,789 D22N probably benign Het
Map4k2 T C 19: 6,345,457 S371P probably damaging Het
Mpp4 A G 1: 59,130,090 F397L probably damaging Het
Mtus2 T C 5: 148,078,184 S596P probably benign Het
Myo3a T A 2: 22,558,289 N25K probably damaging Het
Nadsyn1 T C 7: 143,806,033 T401A probably benign Het
Pde6a A T 18: 61,253,738 E395D probably damaging Het
Plekhm2 A G 4: 141,629,932 V743A probably benign Het
Pzp A T 6: 128,525,145 D80E probably benign Het
Rp1 A T 1: 4,345,352 C1846S probably benign Het
Shbg A G 11: 69,617,188 L117P probably damaging Het
Slc35e1 T C 8: 72,492,571 T6A unknown Homo
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Supt20 A G 3: 54,708,400 probably benign Het
Vcpip1 A T 1: 9,746,379 I593N possibly damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion unknown
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGACGATGGTCAACCTTCCTG -3'
(R):5'- GATGTCTCTGAGCCGTCATCTGTG -3'

Sequencing Primer
(F):5'- CCTTCCTGGACTTAAAATGTGG -3'
(R):5'- TGTACACAGAGCCTGGACC -3'
Posted OnNov 08, 2013