Incidental Mutation 'R0968:Efcab5'
ID83958
Institutional Source Beutler Lab
Gene Symbol Efcab5
Ensembl Gene ENSMUSG00000050944
Gene NameEF-hand calcium binding domain 5
Synonyms4930563A03Rik
MMRRC Submission 039097-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R0968 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location77089915-77188968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77140923 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 42 (R42W)
Ref Sequence ENSEMBL: ENSMUSP00000118152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108400] [ENSMUST00000130901]
Predicted Effect probably damaging
Transcript: ENSMUST00000108400
AA Change: R178W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104037
Gene: ENSMUSG00000050944
AA Change: R178W

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
low complexity region 210 219 N/A INTRINSIC
internal_repeat_1 250 352 2.42e-20 PROSPERO
internal_repeat_1 354 452 2.42e-20 PROSPERO
low complexity region 498 513 N/A INTRINSIC
coiled coil region 749 776 N/A INTRINSIC
GAF 877 1066 1.78e-2 SMART
low complexity region 1235 1245 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130901
AA Change: R42W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118152
Gene: ENSMUSG00000050944
AA Change: R42W

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
internal_repeat_1 114 216 1.89e-19 PROSPERO
internal_repeat_1 218 316 1.89e-19 PROSPERO
low complexity region 362 377 N/A INTRINSIC
coiled coil region 613 640 N/A INTRINSIC
GAF 741 930 1.78e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148985
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency 94% (34/36)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,067,206 V719M probably damaging Het
Abca13 A G 11: 9,298,016 S2588G probably benign Het
Acaca C T 11: 84,239,033 Q405* probably null Het
Brms1l G A 12: 55,866,013 D264N possibly damaging Het
Cabcoco1 T C 10: 68,436,372 M254V probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Coro7 G C 16: 4,670,055 probably benign Het
Cylc2 A G 4: 51,216,706 M1V probably null Het
Cyp3a11 G A 5: 145,862,514 probably benign Het
Dnah10 C T 5: 124,829,577 T4224M probably damaging Het
Dnah2 T C 11: 69,448,519 E3054G possibly damaging Het
Dnm3 A G 1: 162,019,819 probably benign Het
Fgf12 T C 16: 28,162,433 N177S probably null Het
Flt3 C T 5: 147,341,227 V846I possibly damaging Het
Gm11569 A T 11: 99,798,424 probably benign Het
Gm12695 A C 4: 96,762,066 V181G probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Lars C A 18: 42,218,583 R852L probably benign Het
Lca5 T C 9: 83,423,169 T195A probably benign Het
Lrrc40 G A 3: 158,036,789 D14N probably damaging Het
Map4k2 T C 19: 6,345,457 S327P probably damaging Het
Mpp4 A G 1: 59,130,090 F397L probably damaging Het
Mtus2 T C 5: 148,078,184 S596P probably benign Het
Myo3a T A 2: 22,558,289 N25K probably damaging Het
Nadsyn1 T C 7: 143,806,033 T401A probably benign Het
Pde6a A T 18: 61,253,738 E395D probably damaging Het
Plekhm2 A G 4: 141,629,932 V743A probably benign Het
Pzp A T 6: 128,525,145 D80E probably benign Het
Rp1 A T 1: 4,345,352 C1846S probably benign Het
Shbg A G 11: 69,617,188 L117P probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Supt20 A G 3: 54,708,400 probably benign Het
Vcpip1 A T 1: 9,746,379 I593N probably damaging Het
Other mutations in Efcab5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Efcab5 APN 11 77137036 missense probably benign 0.04
IGL01343:Efcab5 APN 11 77129930 missense probably damaging 1.00
IGL02190:Efcab5 APN 11 77121314 missense probably benign 0.38
IGL02270:Efcab5 APN 11 77104313 missense probably damaging 0.97
IGL02572:Efcab5 APN 11 77137888 nonsense probably null
IGL02653:Efcab5 APN 11 77132022 missense probably damaging 0.99
IGL02818:Efcab5 APN 11 77105348 missense probably damaging 0.99
IGL03068:Efcab5 APN 11 77104101 missense probably benign
IGL03222:Efcab5 APN 11 77137367 missense probably benign 0.40
IGL03226:Efcab5 APN 11 77137675 missense possibly damaging 0.92
IGL03257:Efcab5 APN 11 77188770 missense probably damaging 0.99
PIT4131001:Efcab5 UTSW 11 77137691
PIT4418001:Efcab5 UTSW 11 77132051 missense possibly damaging 0.89
R0276:Efcab5 UTSW 11 77129876 missense probably damaging 1.00
R0276:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0277:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0284:Efcab5 UTSW 11 77103527 intron probably benign
R0386:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0386:Efcab5 UTSW 11 77172378 missense probably benign 0.30
R0966:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R1433:Efcab5 UTSW 11 77105378 missense probably benign 0.09
R1673:Efcab5 UTSW 11 77151853 missense probably damaging 0.99
R1842:Efcab5 UTSW 11 77134875 missense probably benign 0.00
R1848:Efcab5 UTSW 11 77103306 missense probably damaging 1.00
R2069:Efcab5 UTSW 11 77172321 missense probably benign 0.06
R3713:Efcab5 UTSW 11 77116182 missense probably damaging 1.00
R4012:Efcab5 UTSW 11 77117830 missense probably damaging 0.98
R4020:Efcab5 UTSW 11 77104104 missense probably benign 0.33
R4391:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4392:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4692:Efcab5 UTSW 11 77113681 missense probably damaging 1.00
R4929:Efcab5 UTSW 11 77103383 missense probably benign 0.36
R4985:Efcab5 UTSW 11 77138229 missense probably damaging 0.98
R4988:Efcab5 UTSW 11 77137252 missense probably damaging 1.00
R5246:Efcab5 UTSW 11 77188845 missense probably damaging 1.00
R5260:Efcab5 UTSW 11 77137651 missense possibly damaging 0.92
R5387:Efcab5 UTSW 11 77134842 missense possibly damaging 0.93
R5516:Efcab5 UTSW 11 77188789 missense possibly damaging 0.62
R5535:Efcab5 UTSW 11 77151921 missense probably damaging 1.00
R5694:Efcab5 UTSW 11 77188875 missense probably benign 0.09
R5922:Efcab5 UTSW 11 77188744 missense probably benign 0.44
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6183:Efcab5 UTSW 11 77137258 missense probably benign 0.04
R6437:Efcab5 UTSW 11 77137902 missense probably benign 0.25
R6442:Efcab5 UTSW 11 77105434 nonsense probably null
R6592:Efcab5 UTSW 11 77113610 missense possibly damaging 0.90
R6769:Efcab5 UTSW 11 77105432 missense probably damaging 0.98
R7257:Efcab5 UTSW 11 77137779 missense probably damaging 0.99
R7285:Efcab5 UTSW 11 77137344 missense probably benign
R7285:Efcab5 UTSW 11 77138215 missense possibly damaging 0.49
X0061:Efcab5 UTSW 11 77116234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCATTGGACTACAACACCCAGC -3'
(R):5'- TTCAACAAGTCGTGCCAGTCCC -3'

Sequencing Primer
(F):5'- AGCTTCAGCTCCAGGACATTC -3'
(R):5'- CCTACGGGCAAGATATAGCTTC -3'
Posted On2013-11-08