Incidental Mutation 'R0969:Ccl20'
ID83970
Institutional Source Beutler Lab
Gene Symbol Ccl20
Ensembl Gene ENSMUSG00000026166
Gene Namechemokine (C-C motif) ligand 20
SynonymsMIP-3[a], MIP3A, ST38, exodus-1, CKb4, MIP-3A, Scya20
MMRRC Submission 039098-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R0969 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location83116766-83119167 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 83117917 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027351] [ENSMUST00000113437] [ENSMUST00000186832]
Predicted Effect probably benign
Transcript: ENSMUST00000027351
SMART Domains Protein: ENSMUSP00000027351
Gene: ENSMUSG00000026166

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SCY 30 90 9.36e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113437
SMART Domains Protein: ENSMUSP00000109064
Gene: ENSMUSG00000026166

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
SCY 30 90 9.36e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186832
SMART Domains Protein: ENSMUSP00000139923
Gene: ENSMUSG00000026166

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
SCY 29 89 9.36e-19 SMART
Meta Mutation Damage Score 0.1296 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The protein encoded by this gene displays chemotactic activity for lymphocytes and can repress proliferation of myeloid progenitors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,080 probably null Het
Afg1l T C 10: 42,318,621 T392A probably damaging Het
Ccdc66 A G 14: 27,497,362 S146P probably damaging Het
Cd2 T A 3: 101,276,055 I313F probably benign Het
Cep350 A T 1: 155,940,826 D374E possibly damaging Het
Cep85l T C 10: 53,281,496 K602E probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dhx8 T C 11: 101,739,700 probably benign Het
Epha3 A T 16: 63,566,636 L878Q probably damaging Het
F2rl2 A T 13: 95,700,953 T169S probably damaging Het
Gpx3 T C 11: 54,909,026 probably benign Het
Ipo5 T A 14: 120,944,525 V1010D possibly damaging Het
Nipbl A T 15: 8,292,228 L2647Q probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr73 T C 2: 88,034,248 D297G probably damaging Het
Pcnt T C 10: 76,427,951 E393G probably damaging Het
Pibf1 C A 14: 99,196,386 Q590K probably benign Het
Pkd1l1 T C 11: 8,936,898 D367G probably damaging Het
Pnpla7 T C 2: 25,050,953 Y1106H probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco5a1 C T 1: 12,989,892 A202T probably damaging Het
Slco6c1 A C 1: 97,119,960 I206R probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srek1 G A 13: 103,752,503 probably benign Het
St8sia6 T A 2: 13,696,869 R112S probably benign Het
Suclg1 T A 6: 73,271,116 H273Q probably benign Het
Taf2 T A 15: 55,031,157 probably null Het
Tctn1 A G 5: 122,241,777 V566A probably benign Het
Trpm4 A G 7: 45,327,907 probably benign Het
Trpv3 C T 11: 73,278,938 Q112* probably null Het
Ttll8 T C 15: 88,933,935 Y179C probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Upk1b A G 16: 38,787,299 probably benign Het
Zfp961 T G 8: 71,968,295 H217Q probably damaging Het
Other mutations in Ccl20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02864:Ccl20 APN 1 83118078 critical splice donor site probably null
IGL03372:Ccl20 APN 1 83117876 missense probably benign 0.03
R1794:Ccl20 UTSW 1 83117829 missense possibly damaging 0.74
R1818:Ccl20 UTSW 1 83117808 missense probably damaging 0.96
R1897:Ccl20 UTSW 1 83117895 missense probably damaging 1.00
R2001:Ccl20 UTSW 1 83117855 frame shift probably null
R4885:Ccl20 UTSW 1 83117859 missense possibly damaging 0.94
R7062:Ccl20 UTSW 1 83117814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAATACAACAGCCCTGGAGTG -3'
(R):5'- AGGAGGTTCACAGCCCTTTTCACC -3'

Sequencing Primer
(F):5'- TTTCTTACTAGAGATGGCGAGAAGC -3'
(R):5'- ACCCAGTTCTGCTTTGGATCAG -3'
Posted On2013-11-08