Incidental Mutation 'R0969:Pnpla7'
ID83975
Institutional Source Beutler Lab
Gene Symbol Pnpla7
Ensembl Gene ENSMUSG00000036833
Gene Namepatatin-like phospholipase domain containing 7
SynonymsNRE, E430013P11Rik
MMRRC Submission 039098-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R0969 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location24976033-25054057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25050953 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1106 (Y1106H)
Ref Sequence ENSEMBL: ENSMUSP00000044078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006646] [ENSMUST00000045295] [ENSMUST00000074422] [ENSMUST00000100334] [ENSMUST00000102931] [ENSMUST00000114386] [ENSMUST00000114388] [ENSMUST00000116574] [ENSMUST00000132172] [ENSMUST00000137913] [ENSMUST00000140737] [ENSMUST00000144520] [ENSMUST00000152122] [ENSMUST00000155601]
Predicted Effect probably benign
Transcript: ENSMUST00000006646
SMART Domains Protein: ENSMUSP00000006646
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 281 292 N/A INTRINSIC
low complexity region 361 375 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000045295
AA Change: Y1106H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044078
Gene: ENSMUSG00000036833
AA Change: Y1106H

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
low complexity region 59 66 N/A INTRINSIC
cNMP 170 295 2.06e-12 SMART
low complexity region 439 444 N/A INTRINSIC
cNMP 481 600 1.16e-6 SMART
cNMP 603 716 1.55e-7 SMART
Pfam:Patatin 950 1116 3.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074422
SMART Domains Protein: ENSMUSP00000074022
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100334
SMART Domains Protein: ENSMUSP00000097908
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
low complexity region 363 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102931
SMART Domains Protein: ENSMUSP00000099995
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 260 271 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114386
SMART Domains Protein: ENSMUSP00000110028
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 310 324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114388
SMART Domains Protein: ENSMUSP00000110030
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 331 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116574
SMART Domains Protein: ENSMUSP00000112273
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 260 271 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132082
Predicted Effect probably benign
Transcript: ENSMUST00000132172
SMART Domains Protein: ENSMUSP00000116106
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135328
Predicted Effect probably benign
Transcript: ENSMUST00000137913
SMART Domains Protein: ENSMUSP00000141577
Gene: ENSMUSG00000036833

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 33 40 N/A INTRINSIC
Pfam:cNMP_binding 162 200 2.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138536
Predicted Effect probably benign
Transcript: ENSMUST00000140737
SMART Domains Protein: ENSMUSP00000141410
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141866
Predicted Effect probably benign
Transcript: ENSMUST00000144520
SMART Domains Protein: ENSMUSP00000141583
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152122
SMART Domains Protein: ENSMUSP00000121580
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
Pfam:IQ 62 80 2.5e-4 PFAM
low complexity region 114 125 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154359
Predicted Effect probably benign
Transcript: ENSMUST00000155601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175104
Meta Mutation Damage Score 0.334 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Human patatin-like phospholipases, such as PNPLA7, have been implicated in regulation of adipocyte differentiation and have been induced by metabolic stimuli (Wilson et al., 2006 [PubMed 16799181]).[supplied by OMIM, Jun 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,080 probably null Het
Afg1l T C 10: 42,318,621 T392A probably damaging Het
Ccdc66 A G 14: 27,497,362 S146P probably damaging Het
Ccl20 T A 1: 83,117,917 probably benign Het
Cd2 T A 3: 101,276,055 I313F probably benign Het
Cep350 A T 1: 155,940,826 D374E possibly damaging Het
Cep85l T C 10: 53,281,496 K602E probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dhx8 T C 11: 101,739,700 probably benign Het
Epha3 A T 16: 63,566,636 L878Q probably damaging Het
F2rl2 A T 13: 95,700,953 T169S probably damaging Het
Gpx3 T C 11: 54,909,026 probably benign Het
Ipo5 T A 14: 120,944,525 V1010D possibly damaging Het
Nipbl A T 15: 8,292,228 L2647Q probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr73 T C 2: 88,034,248 D297G probably damaging Het
Pcnt T C 10: 76,427,951 E393G probably damaging Het
Pibf1 C A 14: 99,196,386 Q590K probably benign Het
Pkd1l1 T C 11: 8,936,898 D367G probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco5a1 C T 1: 12,989,892 A202T probably damaging Het
Slco6c1 A C 1: 97,119,960 I206R probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srek1 G A 13: 103,752,503 probably benign Het
St8sia6 T A 2: 13,696,869 R112S probably benign Het
Suclg1 T A 6: 73,271,116 H273Q probably benign Het
Taf2 T A 15: 55,031,157 probably null Het
Tctn1 A G 5: 122,241,777 V566A probably benign Het
Trpm4 A G 7: 45,327,907 probably benign Het
Trpv3 C T 11: 73,278,938 Q112* probably null Het
Ttll8 T C 15: 88,933,935 Y179C probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Upk1b A G 16: 38,787,299 probably benign Het
Zfp961 T G 8: 71,968,295 H217Q probably damaging Het
Other mutations in Pnpla7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Pnpla7 APN 2 24976315 critical splice donor site probably null
IGL00765:Pnpla7 APN 2 24980224 missense probably damaging 0.98
IGL01576:Pnpla7 APN 2 25016563 missense probably damaging 1.00
IGL01626:Pnpla7 APN 2 25050893 missense possibly damaging 0.58
IGL01844:Pnpla7 APN 2 25050973 critical splice donor site probably null
IGL02280:Pnpla7 APN 2 25011577 missense probably benign 0.00
IGL02629:Pnpla7 APN 2 25050945 missense probably damaging 1.00
IGL02642:Pnpla7 APN 2 25050276 missense probably benign 0.24
IGL02931:Pnpla7 APN 2 25015229 missense possibly damaging 0.87
IGL03162:Pnpla7 APN 2 25015289 unclassified probably benign
PIT4495001:Pnpla7 UTSW 2 25042139 missense probably damaging 0.99
R0047:Pnpla7 UTSW 2 25011606 missense probably damaging 1.00
R0047:Pnpla7 UTSW 2 25011606 missense probably damaging 1.00
R0064:Pnpla7 UTSW 2 24997227 nonsense probably null
R0064:Pnpla7 UTSW 2 24997227 nonsense probably null
R0309:Pnpla7 UTSW 2 24987195 missense probably damaging 1.00
R0541:Pnpla7 UTSW 2 24995293 missense probably damaging 0.99
R0556:Pnpla7 UTSW 2 25052301 splice site probably null
R0565:Pnpla7 UTSW 2 24980117 splice site probably benign
R0830:Pnpla7 UTSW 2 24997255 missense probably damaging 1.00
R0865:Pnpla7 UTSW 2 24982123 missense probably benign 0.34
R0893:Pnpla7 UTSW 2 24997240 missense probably damaging 1.00
R1102:Pnpla7 UTSW 2 24996165 missense probably damaging 1.00
R1551:Pnpla7 UTSW 2 25047708 missense probably benign 0.01
R1572:Pnpla7 UTSW 2 25015251 missense possibly damaging 0.69
R1623:Pnpla7 UTSW 2 25052599 missense probably damaging 1.00
R1876:Pnpla7 UTSW 2 25040973 missense possibly damaging 0.91
R1898:Pnpla7 UTSW 2 25053784 unclassified probably benign
R1909:Pnpla7 UTSW 2 24997288 missense possibly damaging 0.75
R1973:Pnpla7 UTSW 2 25016617 missense probably damaging 1.00
R2230:Pnpla7 UTSW 2 25051598 unclassified probably benign
R2381:Pnpla7 UTSW 2 24980758 missense probably damaging 1.00
R2655:Pnpla7 UTSW 2 25052318 missense probably damaging 1.00
R3125:Pnpla7 UTSW 2 25042138 missense probably damaging 1.00
R4223:Pnpla7 UTSW 2 24982114 missense possibly damaging 0.69
R4411:Pnpla7 UTSW 2 25051704 nonsense probably null
R4573:Pnpla7 UTSW 2 25050873 missense probably damaging 0.98
R4674:Pnpla7 UTSW 2 25052317 missense probably damaging 1.00
R4841:Pnpla7 UTSW 2 24980052 missense probably benign 0.05
R4842:Pnpla7 UTSW 2 24980052 missense probably benign 0.05
R4893:Pnpla7 UTSW 2 25053676 nonsense probably null
R4941:Pnpla7 UTSW 2 24997264 unclassified probably null
R5116:Pnpla7 UTSW 2 25021970 missense probably damaging 0.97
R5126:Pnpla7 UTSW 2 24980044 missense possibly damaging 0.83
R5138:Pnpla7 UTSW 2 25041103 missense possibly damaging 0.88
R5169:Pnpla7 UTSW 2 25050309 missense probably benign 0.03
R5188:Pnpla7 UTSW 2 24997300 missense probably benign 0.06
R5288:Pnpla7 UTSW 2 25041019 missense probably damaging 0.97
R5307:Pnpla7 UTSW 2 25021952 missense possibly damaging 0.81
R5339:Pnpla7 UTSW 2 25002937 missense probably benign 0.10
R5384:Pnpla7 UTSW 2 25041019 missense probably damaging 0.97
R5385:Pnpla7 UTSW 2 25041019 missense probably damaging 0.97
R5479:Pnpla7 UTSW 2 25019441 missense possibly damaging 0.90
R5640:Pnpla7 UTSW 2 25003001 missense possibly damaging 0.92
R5662:Pnpla7 UTSW 2 25052384 missense probably damaging 1.00
R5751:Pnpla7 UTSW 2 24981778 missense probably damaging 0.97
R5874:Pnpla7 UTSW 2 25011649 missense probably benign
R6284:Pnpla7 UTSW 2 25016618 missense possibly damaging 0.79
R6351:Pnpla7 UTSW 2 25011564 missense probably damaging 0.97
R6513:Pnpla7 UTSW 2 25016538 missense possibly damaging 0.62
R7193:Pnpla7 UTSW 2 25051615 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATCTGTTTTCAAGGCAAAGCCC -3'
(R):5'- CTCTAGCAACTGATGCCAACCTGAC -3'

Sequencing Primer
(F):5'- GACCTATGAGCTTTGAGACTGAC -3'
(R):5'- AACTGATGCCAACCTGACATTTTC -3'
Posted On2013-11-08