Incidental Mutation 'R0969:Tctn1'
ID83980
Institutional Source Beutler Lab
Gene Symbol Tctn1
Ensembl Gene ENSMUSG00000038593
Gene Nametectonic family member 1
SynonymsG730031O11Rik, Tect1
MMRRC Submission 039098-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0969 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location122237848-122264460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122241777 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 566 (V566A)
Ref Sequence ENSEMBL: ENSMUSP00000107367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072602] [ENSMUST00000100747] [ENSMUST00000111738] [ENSMUST00000141281] [ENSMUST00000143560] [ENSMUST00000196187]
Predicted Effect probably benign
Transcript: ENSMUST00000072602
SMART Domains Protein: ENSMUSP00000072401
Gene: ENSMUSG00000064267

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
Pfam:Ion_trans 94 226 1.2e-9 PFAM
Pfam:VGPC1_C 222 269 1.5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100747
SMART Domains Protein: ENSMUSP00000098312
Gene: ENSMUSG00000064267

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
low complexity region 104 120 N/A INTRINSIC
Pfam:Ion_trans 137 226 2.9e-7 PFAM
low complexity region 255 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111738
AA Change: V566A

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107367
Gene: ENSMUSG00000038593
AA Change: V566A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 24 36 N/A INTRINSIC
Pfam:DUF1619 82 395 8.4e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141281
SMART Domains Protein: ENSMUSP00000114820
Gene: ENSMUSG00000038593

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 24 36 N/A INTRINSIC
Pfam:DUF1619 82 384 1.5e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143560
SMART Domains Protein: ENSMUSP00000118013
Gene: ENSMUSG00000064267

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
PDB:3WKV|A 73 157 9e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176677
Predicted Effect probably benign
Transcript: ENSMUST00000196187
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of secreted and transmembrane proteins. The orthologous gene in mouse functions downstream of smoothened and rab23 to modulate hedgehog signal transduction. This protein is a component of the tectonic-like complex, which forms a barrier between the ciliary axoneme and the basal body. A mutation in this gene was found in a family with Joubert syndrome-13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality, holoprosencephaly and lack a neural floor plate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,080 probably null Het
Afg1l T C 10: 42,318,621 T392A probably damaging Het
Ccdc66 A G 14: 27,497,362 S146P probably damaging Het
Ccl20 T A 1: 83,117,917 probably benign Het
Cd2 T A 3: 101,276,055 I313F probably benign Het
Cep350 A T 1: 155,940,826 D374E possibly damaging Het
Cep85l T C 10: 53,281,496 K602E probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dhx8 T C 11: 101,739,700 probably benign Het
Epha3 A T 16: 63,566,636 L878Q probably damaging Het
F2rl2 A T 13: 95,700,953 T169S probably damaging Het
Gpx3 T C 11: 54,909,026 probably benign Het
Ipo5 T A 14: 120,944,525 V1010D possibly damaging Het
Nipbl A T 15: 8,292,228 L2647Q probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr73 T C 2: 88,034,248 D297G probably damaging Het
Pcnt T C 10: 76,427,951 E393G probably damaging Het
Pibf1 C A 14: 99,196,386 Q590K probably benign Het
Pkd1l1 T C 11: 8,936,898 D367G probably damaging Het
Pnpla7 T C 2: 25,050,953 Y1106H probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco5a1 C T 1: 12,989,892 A202T probably damaging Het
Slco6c1 A C 1: 97,119,960 I206R probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srek1 G A 13: 103,752,503 probably benign Het
St8sia6 T A 2: 13,696,869 R112S probably benign Het
Suclg1 T A 6: 73,271,116 H273Q probably benign Het
Taf2 T A 15: 55,031,157 probably null Het
Trpm4 A G 7: 45,327,907 probably benign Het
Trpv3 C T 11: 73,278,938 Q112* probably null Het
Ttll8 T C 15: 88,933,935 Y179C probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Upk1b A G 16: 38,787,299 probably benign Het
Zfp961 T G 8: 71,968,295 H217Q probably damaging Het
Other mutations in Tctn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Tctn1 APN 5 122264207 missense probably benign 0.03
IGL02019:Tctn1 APN 5 122258849 missense probably damaging 1.00
IGL02810:Tctn1 APN 5 122242601 splice site probably null
R0648:Tctn1 UTSW 5 122251698 missense probably benign 0.00
R0883:Tctn1 UTSW 5 122264144 missense probably damaging 1.00
R1172:Tctn1 UTSW 5 122251689 nonsense probably null
R1959:Tctn1 UTSW 5 122241840 splice site probably null
R2099:Tctn1 UTSW 5 122242709 missense probably damaging 1.00
R4707:Tctn1 UTSW 5 122261405 critical splice donor site probably null
R4836:Tctn1 UTSW 5 122245505 missense probably benign
R5437:Tctn1 UTSW 5 122258879 missense probably benign 0.29
R6149:Tctn1 UTSW 5 122246586 missense probably benign 0.01
R6358:Tctn1 UTSW 5 122261512 missense probably damaging 0.99
R6629:Tctn1 UTSW 5 122242668 missense probably damaging 1.00
R6744:Tctn1 UTSW 5 122264146 missense probably damaging 1.00
R6899:Tctn1 UTSW 5 122248956 missense probably damaging 0.98
R7332:Tctn1 UTSW 5 122261484 missense probably damaging 1.00
Z1088:Tctn1 UTSW 5 122251641 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAGACCAGGGATGATGCACTGAC -3'
(R):5'- GCCTGACAGGTTTTATTTGTGAGCAC -3'

Sequencing Primer
(F):5'- GCCCAGCAGAGTAAAGTTTC -3'
(R):5'- ACTGTGGTTGGACCAGCTC -3'
Posted On2013-11-08