Incidental Mutation 'R0969:Cep85l'
ID83988
Institutional Source Beutler Lab
Gene Symbol Cep85l
Ensembl Gene ENSMUSG00000038594
Gene Namecentrosomal protein 85-like
SynonymsGm9766
MMRRC Submission 039098-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R0969 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location53273443-53379947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53281496 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 602 (K602E)
Ref Sequence ENSEMBL: ENSMUSP00000152032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095691] [ENSMUST00000220376] [ENSMUST00000220443]
Predicted Effect probably benign
Transcript: ENSMUST00000095691
AA Change: K602E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000093356
Gene: ENSMUSG00000038594
AA Change: K602E

DomainStartEndE-ValueType
coiled coil region 442 578 N/A INTRINSIC
coiled coil region 600 645 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219618
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219673
Predicted Effect probably benign
Transcript: ENSMUST00000220376
AA Change: K602E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000220443
AA Change: K704E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.002 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified as a breast cancer antigen. Nothing more is known of its function at this time. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,080 probably null Het
Afg1l T C 10: 42,318,621 T392A probably damaging Het
Ccdc66 A G 14: 27,497,362 S146P probably damaging Het
Ccl20 T A 1: 83,117,917 probably benign Het
Cd2 T A 3: 101,276,055 I313F probably benign Het
Cep350 A T 1: 155,940,826 D374E possibly damaging Het
Cndp1 G A 18: 84,634,652 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dhx8 T C 11: 101,739,700 probably benign Het
Epha3 A T 16: 63,566,636 L878Q probably damaging Het
F2rl2 A T 13: 95,700,953 T169S probably damaging Het
Gpx3 T C 11: 54,909,026 probably benign Het
Ipo5 T A 14: 120,944,525 V1010D possibly damaging Het
Nipbl A T 15: 8,292,228 L2647Q probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr73 T C 2: 88,034,248 D297G probably damaging Het
Pcnt T C 10: 76,427,951 E393G probably damaging Het
Pibf1 C A 14: 99,196,386 Q590K probably benign Het
Pkd1l1 T C 11: 8,936,898 D367G probably damaging Het
Pnpla7 T C 2: 25,050,953 Y1106H probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco5a1 C T 1: 12,989,892 A202T probably damaging Het
Slco6c1 A C 1: 97,119,960 I206R probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srek1 G A 13: 103,752,503 probably benign Het
St8sia6 T A 2: 13,696,869 R112S probably benign Het
Suclg1 T A 6: 73,271,116 H273Q probably benign Het
Taf2 T A 15: 55,031,157 probably null Het
Tctn1 A G 5: 122,241,777 V566A probably benign Het
Trpm4 A G 7: 45,327,907 probably benign Het
Trpv3 C T 11: 73,278,938 Q112* probably null Het
Ttll8 T C 15: 88,933,935 Y179C probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Upk1b A G 16: 38,787,299 probably benign Het
Zfp961 T G 8: 71,968,295 H217Q probably damaging Het
Other mutations in Cep85l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0103:Cep85l UTSW 10 53278174 missense possibly damaging 0.53
R0103:Cep85l UTSW 10 53278174 missense possibly damaging 0.53
R0559:Cep85l UTSW 10 53348501 missense probably benign 0.00
R0689:Cep85l UTSW 10 53348847 missense probably damaging 1.00
R0750:Cep85l UTSW 10 53281546 missense probably damaging 0.99
R1375:Cep85l UTSW 10 53349258 missense probably damaging 0.99
R1542:Cep85l UTSW 10 53301584 missense probably damaging 1.00
R1611:Cep85l UTSW 10 53348681 missense probably benign
R1749:Cep85l UTSW 10 53278154 missense probably damaging 1.00
R1826:Cep85l UTSW 10 53348812 missense possibly damaging 0.89
R2007:Cep85l UTSW 10 53278075 utr 3 prime probably benign
R2043:Cep85l UTSW 10 53358128 missense possibly damaging 0.64
R2144:Cep85l UTSW 10 53358126 missense probably benign 0.04
R2186:Cep85l UTSW 10 53348618 missense probably damaging 0.97
R2201:Cep85l UTSW 10 53348731 missense probably benign 0.01
R3767:Cep85l UTSW 10 53291810 missense probably benign 0.09
R5249:Cep85l UTSW 10 53319594 splice site probably null
R5764:Cep85l UTSW 10 53348994 missense probably benign 0.00
R6207:Cep85l UTSW 10 53281555 missense probably benign
R6333:Cep85l UTSW 10 53349101 nonsense probably null
R6422:Cep85l UTSW 10 53291780 missense possibly damaging 0.62
R6511:Cep85l UTSW 10 53278092 missense probably benign 0.00
R6645:Cep85l UTSW 10 53301672 missense probably benign 0.26
R6863:Cep85l UTSW 10 53349118 missense probably damaging 1.00
R6904:Cep85l UTSW 10 53349098 missense probably benign 0.00
R7000:Cep85l UTSW 10 53298199 missense probably damaging 1.00
R7015:Cep85l UTSW 10 53349055 missense possibly damaging 0.89
R7256:Cep85l UTSW 10 53296255 missense probably damaging 1.00
R7425:Cep85l UTSW 10 53301570 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCACTTACATCGGATTCCCAG -3'
(R):5'- TGATGGCACAGAGGAGTCAGCTTG -3'

Sequencing Primer
(F):5'- TCGGATTCCCAGTAACAATGAG -3'
(R):5'- CCCTACTGAATGTGTGCAGC -3'
Posted On2013-11-08