Incidental Mutation 'R0969:Gpx3'
ID83991
Institutional Source Beutler Lab
Gene Symbol Gpx3
Ensembl Gene ENSMUSG00000018339
Gene Nameglutathione peroxidase 3
SynonymsGPx, EGPx, extracellular GPx, plasma GPx
MMRRC Submission 039098-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R0969 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location54902453-54910377 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 54909026 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018482] [ENSMUST00000082430] [ENSMUST00000102730] [ENSMUST00000102731] [ENSMUST00000108885] [ENSMUST00000108886] [ENSMUST00000108889] [ENSMUST00000125094] [ENSMUST00000149324]
Predicted Effect probably benign
Transcript: ENSMUST00000018482
SMART Domains Protein: ENSMUSP00000018482
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082430
SMART Domains Protein: ENSMUSP00000081011
Gene: ENSMUSG00000018339

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:GSHPx 40 153 4.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102730
SMART Domains Protein: ENSMUSP00000099791
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 3e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 627 640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102731
SMART Domains Protein: ENSMUSP00000099792
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108885
SMART Domains Protein: ENSMUSP00000104513
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
coiled coil region 162 213 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SCOP:d1bg1a1 289 458 5e-4 SMART
low complexity region 466 490 N/A INTRINSIC
low complexity region 507 524 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108886
SMART Domains Protein: ENSMUSP00000104514
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
coiled coil region 162 213 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SCOP:d1bg1a1 289 458 5e-4 SMART
low complexity region 466 490 N/A INTRINSIC
low complexity region 507 524 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108889
SMART Domains Protein: ENSMUSP00000104517
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124304
Predicted Effect probably benign
Transcript: ENSMUST00000125094
SMART Domains Protein: ENSMUSP00000119165
Gene: ENSMUSG00000018339

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:GSHPx 40 153 1.6e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149324
SMART Domains Protein: ENSMUSP00000119882
Gene: ENSMUSG00000018339

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:GSHPx 40 83 1e-13 PFAM
Pfam:GSHPx 99 185 7.3e-28 PFAM
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is secreted and is highly expressed in mouse kidney, which appears to be the major source of the enzyme in plasma. It has a role in mouse organogenesis, and dysregulation of this isozyme has been associated with obesity-related metabolic complications, platelet-dependent thrombosis, colitis-associated carcinoma, and thermosensitive phenotype. This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced glutathione peroxidase activity, increase plasma selenium levels when mice are fed a selenium supplemented diet, and reduced kidney selenium levels regardless of selenium supplementation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,080 probably null Het
Afg1l T C 10: 42,318,621 T392A probably damaging Het
Ccdc66 A G 14: 27,497,362 S146P probably damaging Het
Ccl20 T A 1: 83,117,917 probably benign Het
Cd2 T A 3: 101,276,055 I313F probably benign Het
Cep350 A T 1: 155,940,826 D374E possibly damaging Het
Cep85l T C 10: 53,281,496 K602E probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dhx8 T C 11: 101,739,700 probably benign Het
Epha3 A T 16: 63,566,636 L878Q probably damaging Het
F2rl2 A T 13: 95,700,953 T169S probably damaging Het
Ipo5 T A 14: 120,944,525 V1010D possibly damaging Het
Nipbl A T 15: 8,292,228 L2647Q probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr73 T C 2: 88,034,248 D297G probably damaging Het
Pcnt T C 10: 76,427,951 E393G probably damaging Het
Pibf1 C A 14: 99,196,386 Q590K probably benign Het
Pkd1l1 T C 11: 8,936,898 D367G probably damaging Het
Pnpla7 T C 2: 25,050,953 Y1106H probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco5a1 C T 1: 12,989,892 A202T probably damaging Het
Slco6c1 A C 1: 97,119,960 I206R probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srek1 G A 13: 103,752,503 probably benign Het
St8sia6 T A 2: 13,696,869 R112S probably benign Het
Suclg1 T A 6: 73,271,116 H273Q probably benign Het
Taf2 T A 15: 55,031,157 probably null Het
Tctn1 A G 5: 122,241,777 V566A probably benign Het
Trpm4 A G 7: 45,327,907 probably benign Het
Trpv3 C T 11: 73,278,938 Q112* probably null Het
Ttll8 T C 15: 88,933,935 Y179C probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Upk1b A G 16: 38,787,299 probably benign Het
Zfp961 T G 8: 71,968,295 H217Q probably damaging Het
Other mutations in Gpx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02125:Gpx3 APN 11 54907242 missense probably damaging 1.00
IGL02600:Gpx3 APN 11 54909607 missense possibly damaging 0.84
R0589:Gpx3 UTSW 11 54909503 missense probably benign 0.00
R1344:Gpx3 UTSW 11 54909596 missense probably damaging 0.99
R1418:Gpx3 UTSW 11 54909596 missense probably damaging 0.99
R5105:Gpx3 UTSW 11 54907154 missense possibly damaging 0.82
R5390:Gpx3 UTSW 11 54909549 missense probably damaging 0.98
R6476:Gpx3 UTSW 11 54907199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGGCAGCACATTGAAGGGTAG -3'
(R):5'- TCATGGGTTCCCAAAAGAGGCG -3'

Sequencing Primer
(F):5'- CACATTGAAGGGTAGAGATGTGG -3'
(R):5'- CCATCTCTATGCTGACTGGAAGG -3'
Posted On2013-11-08