Incidental Mutation 'R0969:Taf2'
ID84001
Institutional Source Beutler Lab
Gene Symbol Taf2
Ensembl Gene ENSMUSG00000037343
Gene NameTATA-box binding protein associated factor 2
SynonymsCIF150, 150kDa, TAF2B, 4732460C16Rik, TAFII150
MMRRC Submission 039098-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0969 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location55015131-55072152 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 55031157 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041733]
Predicted Effect probably null
Transcript: ENSMUST00000041733
SMART Domains Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343

DomainStartEndE-ValueType
Pfam:Peptidase_M1 21 406 5.6e-17 PFAM
SCOP:d1gw5a_ 606 973 6e-7 SMART
low complexity region 987 998 N/A INTRINSIC
low complexity region 1142 1175 N/A INTRINSIC
Meta Mutation Damage Score 0.734 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,080 probably null Het
Afg1l T C 10: 42,318,621 T392A probably damaging Het
Ccdc66 A G 14: 27,497,362 S146P probably damaging Het
Ccl20 T A 1: 83,117,917 probably benign Het
Cd2 T A 3: 101,276,055 I313F probably benign Het
Cep350 A T 1: 155,940,826 D374E possibly damaging Het
Cep85l T C 10: 53,281,496 K602E probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dhx8 T C 11: 101,739,700 probably benign Het
Epha3 A T 16: 63,566,636 L878Q probably damaging Het
F2rl2 A T 13: 95,700,953 T169S probably damaging Het
Gpx3 T C 11: 54,909,026 probably benign Het
Ipo5 T A 14: 120,944,525 V1010D possibly damaging Het
Nipbl A T 15: 8,292,228 L2647Q probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr73 T C 2: 88,034,248 D297G probably damaging Het
Pcnt T C 10: 76,427,951 E393G probably damaging Het
Pibf1 C A 14: 99,196,386 Q590K probably benign Het
Pkd1l1 T C 11: 8,936,898 D367G probably damaging Het
Pnpla7 T C 2: 25,050,953 Y1106H probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco5a1 C T 1: 12,989,892 A202T probably damaging Het
Slco6c1 A C 1: 97,119,960 I206R probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srek1 G A 13: 103,752,503 probably benign Het
St8sia6 T A 2: 13,696,869 R112S probably benign Het
Suclg1 T A 6: 73,271,116 H273Q probably benign Het
Tctn1 A G 5: 122,241,777 V566A probably benign Het
Trpm4 A G 7: 45,327,907 probably benign Het
Trpv3 C T 11: 73,278,938 Q112* probably null Het
Ttll8 T C 15: 88,933,935 Y179C probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Upk1b A G 16: 38,787,299 probably benign Het
Zfp961 T G 8: 71,968,295 H217Q probably damaging Het
Other mutations in Taf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Taf2 APN 15 55071449 critical splice acceptor site probably null
IGL00475:Taf2 APN 15 55055850 nonsense probably null
IGL00549:Taf2 APN 15 55031115 missense probably benign 0.03
IGL00839:Taf2 APN 15 55045778 nonsense probably null
IGL01089:Taf2 APN 15 55016581 missense probably benign
IGL01305:Taf2 APN 15 55048274 missense probably damaging 0.99
IGL01532:Taf2 APN 15 55049486 missense possibly damaging 0.94
IGL01903:Taf2 APN 15 55060016 missense probably benign 0.03
IGL02324:Taf2 APN 15 55028376 missense probably benign
IGL02328:Taf2 APN 15 55028376 missense probably benign
IGL02405:Taf2 APN 15 55034155 splice site probably benign
IGL02671:Taf2 APN 15 55034176 missense probably benign 0.01
IGL02832:Taf2 APN 15 55016563 missense probably benign 0.01
IGL03105:Taf2 APN 15 55045799 missense probably benign 0.26
IGL03118:Taf2 APN 15 55052163 missense probably damaging 1.00
ANU22:Taf2 UTSW 15 55048274 missense probably damaging 0.99
R0104:Taf2 UTSW 15 55038338 missense probably benign 0.02
R0104:Taf2 UTSW 15 55038338 missense probably benign 0.02
R0183:Taf2 UTSW 15 55055790 missense possibly damaging 0.89
R0326:Taf2 UTSW 15 55047460 missense probably damaging 0.97
R0362:Taf2 UTSW 15 55045929 missense probably damaging 1.00
R0423:Taf2 UTSW 15 55064682 missense probably benign 0.02
R0562:Taf2 UTSW 15 55022188 splice site probably benign
R0609:Taf2 UTSW 15 55060050 missense probably damaging 1.00
R0655:Taf2 UTSW 15 55038294 missense probably damaging 1.00
R0689:Taf2 UTSW 15 55063065 missense possibly damaging 0.60
R0743:Taf2 UTSW 15 55016461 small deletion probably benign
R0898:Taf2 UTSW 15 55060084 missense probably damaging 0.97
R0974:Taf2 UTSW 15 55016461 small deletion probably benign
R1145:Taf2 UTSW 15 55016461 small deletion probably benign
R1145:Taf2 UTSW 15 55016461 small deletion probably benign
R1160:Taf2 UTSW 15 55071397 missense probably benign 0.01
R1376:Taf2 UTSW 15 55016461 small deletion probably benign
R1388:Taf2 UTSW 15 55036625 missense probably benign 0.00
R1416:Taf2 UTSW 15 55038410 missense possibly damaging 0.95
R1458:Taf2 UTSW 15 55059915 missense probably damaging 0.99
R1477:Taf2 UTSW 15 55062172 missense possibly damaging 0.87
R1755:Taf2 UTSW 15 55016454 missense probably damaging 1.00
R1766:Taf2 UTSW 15 55071397 missense probably benign 0.01
R2090:Taf2 UTSW 15 55016486 missense probably damaging 0.99
R2228:Taf2 UTSW 15 55064646 missense possibly damaging 0.94
R2519:Taf2 UTSW 15 55052247 missense probably benign 0.03
R4073:Taf2 UTSW 15 55052237 missense probably damaging 1.00
R4470:Taf2 UTSW 15 55058880 missense possibly damaging 0.70
R4471:Taf2 UTSW 15 55058880 missense possibly damaging 0.70
R4472:Taf2 UTSW 15 55058880 missense possibly damaging 0.70
R4716:Taf2 UTSW 15 55065968 missense probably benign 0.02
R4937:Taf2 UTSW 15 55027223 nonsense probably null
R5082:Taf2 UTSW 15 55060045 missense probably benign 0.41
R5335:Taf2 UTSW 15 55045740 missense probably benign 0.14
R5383:Taf2 UTSW 15 55049419 missense possibly damaging 0.78
R5771:Taf2 UTSW 15 55059939 missense probably benign 0.01
R5862:Taf2 UTSW 15 55048323 missense possibly damaging 0.95
R5873:Taf2 UTSW 15 55038422 missense probably benign 0.00
R5908:Taf2 UTSW 15 55072006 unclassified probably benign
R6033:Taf2 UTSW 15 55058901 missense probably damaging 1.00
R6033:Taf2 UTSW 15 55058901 missense probably damaging 1.00
R6159:Taf2 UTSW 15 55063044 missense possibly damaging 0.48
R6568:Taf2 UTSW 15 55064630 missense probably damaging 1.00
R7094:Taf2 UTSW 15 55060086 missense probably benign 0.27
R7174:Taf2 UTSW 15 55048739 missense possibly damaging 0.51
R7241:Taf2 UTSW 15 55062141 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTTCACTCCATGCAAACCCGC -3'
(R):5'- GGTAGAAGACCTTGTTGGACAGTTCAGA -3'

Sequencing Primer
(F):5'- ggggaagattacaacagtggag -3'
(R):5'- CAAACCCATAAGACATTTTAGTGAGG -3'
Posted On2013-11-08