Incidental Mutation 'R0969:Upk1b'
ID84003
Institutional Source Beutler Lab
Gene Symbol Upk1b
Ensembl Gene ENSMUSG00000049436
Gene Nameuroplakin 1B
SynonymsTspan20, Upk1
MMRRC Submission 039098-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0969 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location38773184-38800328 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 38787299 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000052469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057767]
Predicted Effect probably benign
Transcript: ENSMUST00000057767
SMART Domains Protein: ENSMUSP00000052469
Gene: ENSMUSG00000049436

DomainStartEndE-ValueType
Pfam:Tetraspannin 10 258 6.9e-29 PFAM
Meta Mutation Damage Score 0.1652 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is found in the asymmetrical unit membrane (AUM) where it can form a complex with other transmembrane 4 superfamily proteins. It may play a role in normal bladder epithelial physiology, possibly in regulating membrane permeability of superficial umbrella cells or in stabilizing the apical membrane through AUM/cytoskeletal interactions. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a reporter allele are viable, fertile, and physically and behaviorally normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,080 probably null Het
Afg1l T C 10: 42,318,621 T392A probably damaging Het
Ccdc66 A G 14: 27,497,362 S146P probably damaging Het
Ccl20 T A 1: 83,117,917 probably benign Het
Cd2 T A 3: 101,276,055 I313F probably benign Het
Cep350 A T 1: 155,940,826 D374E possibly damaging Het
Cep85l T C 10: 53,281,496 K602E probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dhx8 T C 11: 101,739,700 probably benign Het
Epha3 A T 16: 63,566,636 L878Q probably damaging Het
F2rl2 A T 13: 95,700,953 T169S probably damaging Het
Gpx3 T C 11: 54,909,026 probably benign Het
Ipo5 T A 14: 120,944,525 V1010D possibly damaging Het
Nipbl A T 15: 8,292,228 L2647Q probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr73 T C 2: 88,034,248 D297G probably damaging Het
Pcnt T C 10: 76,427,951 E393G probably damaging Het
Pibf1 C A 14: 99,196,386 Q590K probably benign Het
Pkd1l1 T C 11: 8,936,898 D367G probably damaging Het
Pnpla7 T C 2: 25,050,953 Y1106H probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco5a1 C T 1: 12,989,892 A202T probably damaging Het
Slco6c1 A C 1: 97,119,960 I206R probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srek1 G A 13: 103,752,503 probably benign Het
St8sia6 T A 2: 13,696,869 R112S probably benign Het
Suclg1 T A 6: 73,271,116 H273Q probably benign Het
Taf2 T A 15: 55,031,157 probably null Het
Tctn1 A G 5: 122,241,777 V566A probably benign Het
Trpm4 A G 7: 45,327,907 probably benign Het
Trpv3 C T 11: 73,278,938 Q112* probably null Het
Ttll8 T C 15: 88,933,935 Y179C probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Zfp961 T G 8: 71,968,295 H217Q probably damaging Het
Other mutations in Upk1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Upk1b APN 16 38780016 missense possibly damaging 0.93
IGL00953:Upk1b APN 16 38779985 missense possibly damaging 0.95
IGL02879:Upk1b APN 16 38776278 splice site probably benign
IGL03067:Upk1b APN 16 38784910 missense probably damaging 1.00
R1755:Upk1b UTSW 16 38780040 missense probably benign 0.04
R1916:Upk1b UTSW 16 38776186 critical splice donor site probably null
R1989:Upk1b UTSW 16 38784241 missense possibly damaging 0.94
R2101:Upk1b UTSW 16 38780137 nonsense probably null
R2375:Upk1b UTSW 16 38787128 missense probably damaging 1.00
R4564:Upk1b UTSW 16 38780107 missense probably benign 0.00
R4796:Upk1b UTSW 16 38787242 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CCTACTATGGCTAGAACGGACAAGCAG -3'
(R):5'- AGGGGCTTTATGGATCTTTTCCCAAC -3'

Sequencing Primer
(F):5'- CAGAAGAGGCAGATGCCCAC -3'
(R):5'- AATTAAAGGCAGAAGGTATATGGAAG -3'
Posted On2013-11-08