Incidental Mutation 'R0970:Gapvd1'
ID84008
Institutional Source Beutler Lab
Gene Symbol Gapvd1
Ensembl Gene ENSMUSG00000026867
Gene NameGTPase activating protein and VPS9 domains 1
Synonyms4432404J10Rik, 2010005B09Rik
MMRRC Submission 039099-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0970 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location34674594-34755232 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 34730613 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028224] [ENSMUST00000102800] [ENSMUST00000113099] [ENSMUST00000142436]
Predicted Effect probably benign
Transcript: ENSMUST00000028224
AA Change: H12L

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000028224
Gene: ENSMUSG00000026867
AA Change: H12L

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.3e-36 PFAM
internal_repeat_1 626 655 3.27e-5 PROSPERO
low complexity region 664 678 N/A INTRINSIC
internal_repeat_1 686 717 3.27e-5 PROSPERO
low complexity region 875 890 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
VPS9 1332 1437 1.08e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102800
AA Change: H12L

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099864
Gene: ENSMUSG00000026867
AA Change: H12L

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.3e-36 PFAM
internal_repeat_1 626 655 3.27e-5 PROSPERO
low complexity region 664 678 N/A INTRINSIC
internal_repeat_1 686 717 3.27e-5 PROSPERO
low complexity region 875 890 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
VPS9 1332 1437 1.08e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113099
AA Change: H12L

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108723
Gene: ENSMUSG00000026867
AA Change: H12L

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.8e-37 PFAM
internal_repeat_1 647 676 3.6e-5 PROSPERO
low complexity region 685 699 N/A INTRINSIC
internal_repeat_1 707 738 3.6e-5 PROSPERO
low complexity region 896 911 N/A INTRINSIC
low complexity region 930 941 N/A INTRINSIC
low complexity region 944 954 N/A INTRINSIC
low complexity region 957 973 N/A INTRINSIC
low complexity region 993 1003 N/A INTRINSIC
VPS9 1353 1458 1.08e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113103
SMART Domains Protein: ENSMUSP00000108727
Gene: ENSMUSG00000026867

DomainStartEndE-ValueType
Pfam:RasGAP 1 184 4.9e-32 PFAM
internal_repeat_1 484 513 1.18e-5 PROSPERO
low complexity region 522 536 N/A INTRINSIC
internal_repeat_1 544 575 1.18e-5 PROSPERO
low complexity region 733 748 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
low complexity region 781 791 N/A INTRINSIC
low complexity region 794 810 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000137528
SMART Domains Protein: ENSMUSP00000120138
Gene: ENSMUSG00000026867

DomainStartEndE-ValueType
Pfam:RasGAP 15 216 1.2e-37 PFAM
internal_repeat_1 510 539 1.19e-5 PROSPERO
low complexity region 548 562 N/A INTRINSIC
internal_repeat_1 570 601 1.19e-5 PROSPERO
low complexity region 733 748 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
low complexity region 781 791 N/A INTRINSIC
low complexity region 794 810 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142436
AA Change: H12L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126225
Gene: ENSMUSG00000026867
AA Change: H12L

DomainStartEndE-ValueType
SCOP:d1wer__ 95 135 6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169207
Meta Mutation Damage Score 0.302 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 T C 4: 128,767,571 S307P probably damaging Het
Amdhd2 C T 17: 24,156,570 probably null Het
Ano1 A T 7: 144,595,571 M851K probably benign Het
Arid3b A T 9: 57,833,551 probably benign Het
Arpp21 A G 9: 112,136,448 probably benign Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
C87436 G A 6: 86,447,328 V281M probably damaging Het
Cep70 A G 9: 99,275,599 K184E possibly damaging Het
Clcn7 T C 17: 25,151,234 probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col4a2 A G 8: 11,415,438 T383A probably benign Het
Commd5 A T 15: 76,900,685 probably null Het
Cyp4b1 G A 4: 115,635,636 A292V probably benign Het
Dthd1 T C 5: 62,887,981 L696P probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Eepd1 A G 9: 25,603,426 R510G probably damaging Het
Eno3 T C 11: 70,660,802 I196T probably damaging Het
Eva1a A G 6: 82,092,103 E137G probably damaging Het
Ggnbp2 T C 11: 84,862,312 M34V possibly damaging Het
Gpihbp1 G A 15: 75,597,946 S170N probably benign Het
Kdm3b T C 18: 34,809,039 S528P probably damaging Het
Lrrk2 A T 15: 91,729,169 Q832L probably benign Het
Nav2 C A 7: 49,584,153 P1861Q probably damaging Het
Olfr669 A C 7: 104,939,077 M184L probably benign Het
Piezo1 A T 8: 122,486,810 I1782N possibly damaging Het
Pikfyve T A 1: 65,265,824 S1757T probably damaging Het
Plxnb1 G T 9: 109,103,263 W523C probably damaging Het
Pmm2 G T 16: 8,642,776 L31F probably damaging Het
Ppm1f T C 16: 16,903,593 probably null Het
Prss16 T C 13: 22,005,117 Y34C probably damaging Het
Slc10a2 C G 8: 5,105,115 E23D probably benign Het
Smc5 T A 19: 23,238,998 I489F probably damaging Het
Snx2 T C 18: 53,210,690 probably benign Het
Stradb C T 1: 58,977,060 L3F possibly damaging Het
Tnxb C G 17: 34,698,943 P2277A possibly damaging Het
Tpm2 T A 4: 43,515,968 I270F probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Urb1 A T 16: 90,769,447 L1484Q possibly damaging Het
Xylt1 G A 7: 117,634,736 V497I probably damaging Het
Other mutations in Gapvd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Gapvd1 APN 2 34699860 missense probably benign 0.00
IGL00985:Gapvd1 APN 2 34695563 missense probably damaging 0.99
IGL01133:Gapvd1 APN 2 34725398 missense probably damaging 0.98
IGL01347:Gapvd1 APN 2 34706696 critical splice donor site probably null
IGL01830:Gapvd1 APN 2 34688956 missense probably benign 0.44
IGL01865:Gapvd1 APN 2 34695503 missense probably null
IGL02009:Gapvd1 APN 2 34704191 missense probably damaging 1.00
IGL02014:Gapvd1 APN 2 34704191 missense probably damaging 1.00
IGL02189:Gapvd1 APN 2 34728544 missense probably damaging 1.00
IGL02418:Gapvd1 APN 2 34730518 missense probably benign 0.00
IGL02632:Gapvd1 APN 2 34684174 splice site probably benign
IGL02636:Gapvd1 APN 2 34725404 missense probably benign 0.01
IGL02643:Gapvd1 APN 2 34704180 missense probably damaging 1.00
IGL03271:Gapvd1 APN 2 34727207 unclassified probably benign
P0023:Gapvd1 UTSW 2 34706688 splice site probably benign
R0016:Gapvd1 UTSW 2 34699913 splice site probably benign
R0016:Gapvd1 UTSW 2 34699913 splice site probably benign
R0029:Gapvd1 UTSW 2 34678141 missense probably damaging 1.00
R0029:Gapvd1 UTSW 2 34678141 missense probably damaging 1.00
R0282:Gapvd1 UTSW 2 34688960 nonsense probably null
R0414:Gapvd1 UTSW 2 34693427 missense probably benign 0.14
R0443:Gapvd1 UTSW 2 34704621 intron probably benign
R0542:Gapvd1 UTSW 2 34725036 unclassified probably benign
R0570:Gapvd1 UTSW 2 34728540 missense probably damaging 1.00
R0840:Gapvd1 UTSW 2 34729113 missense probably benign 0.29
R0866:Gapvd1 UTSW 2 34709217 missense probably damaging 1.00
R0890:Gapvd1 UTSW 2 34712317 missense probably damaging 1.00
R0926:Gapvd1 UTSW 2 34712325 missense probably damaging 1.00
R1168:Gapvd1 UTSW 2 34704469 missense probably damaging 1.00
R1391:Gapvd1 UTSW 2 34706802 missense probably damaging 1.00
R1577:Gapvd1 UTSW 2 34709228 missense probably damaging 1.00
R1585:Gapvd1 UTSW 2 34712195 missense possibly damaging 0.93
R1669:Gapvd1 UTSW 2 34730682 critical splice acceptor site probably null
R1677:Gapvd1 UTSW 2 34700761 critical splice donor site probably null
R1812:Gapvd1 UTSW 2 34725064 nonsense probably null
R1874:Gapvd1 UTSW 2 34706021 missense probably damaging 1.00
R1878:Gapvd1 UTSW 2 34725200 missense probably benign 0.00
R1974:Gapvd1 UTSW 2 34700841 missense probably damaging 0.99
R2111:Gapvd1 UTSW 2 34684317 missense probably benign 0.08
R2921:Gapvd1 UTSW 2 34688863 missense probably damaging 0.97
R2923:Gapvd1 UTSW 2 34688863 missense probably damaging 0.97
R3846:Gapvd1 UTSW 2 34729072 nonsense probably null
R3894:Gapvd1 UTSW 2 34728476 missense probably benign 0.23
R4405:Gapvd1 UTSW 2 34728735 missense probably damaging 1.00
R4605:Gapvd1 UTSW 2 34728537 missense probably damaging 1.00
R4770:Gapvd1 UTSW 2 34691181 missense probably damaging 0.98
R4935:Gapvd1 UTSW 2 34704492 nonsense probably null
R5218:Gapvd1 UTSW 2 34728476 missense probably benign 0.23
R5490:Gapvd1 UTSW 2 34693433 missense probably benign 0.23
R5571:Gapvd1 UTSW 2 34715253 missense probably damaging 1.00
R5588:Gapvd1 UTSW 2 34709154 missense probably damaging 1.00
R5933:Gapvd1 UTSW 2 34684291 missense probably benign 0.27
R6117:Gapvd1 UTSW 2 34690459 splice site probably null
R6661:Gapvd1 UTSW 2 34728438 missense probably damaging 1.00
R6857:Gapvd1 UTSW 2 34728377 missense probably damaging 1.00
R6950:Gapvd1 UTSW 2 34684245 missense probably benign 0.04
R7009:Gapvd1 UTSW 2 34700817 missense probably damaging 1.00
R7125:Gapvd1 UTSW 2 34695600 missense probably benign
R7154:Gapvd1 UTSW 2 34725063 missense probably damaging 1.00
R7316:Gapvd1 UTSW 2 34704669 missense probably damaging 1.00
R7358:Gapvd1 UTSW 2 34690461 critical splice donor site probably null
R7363:Gapvd1 UTSW 2 34712195 missense probably benign 0.01
R7371:Gapvd1 UTSW 2 34717373 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAATGGcatgaacaccaggca -3'
(R):5'- CTCAGATTTTGATGTGACTACCCATCCC -3'

Sequencing Primer
(F):5'- acagagaaaccctatcttgaaaaac -3'
(R):5'- GAAAGAGTCTTTACTGTGT -3'
Posted On2013-11-08