Incidental Mutation 'R1083:Il12a'
ID 84908
Institutional Source Beutler Lab
Gene Symbol Il12a
Ensembl Gene ENSMUSG00000027776
Gene Name interleukin 12a
Synonyms p35, IL-12p35
MMRRC Submission 039169-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1083 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 68597977-68605880 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 68602666 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 112 (T112M)
Ref Sequence ENSEMBL: ENSMUSP00000103446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029345] [ENSMUST00000107816]
AlphaFold P43431
Predicted Effect probably damaging
Transcript: ENSMUST00000029345
AA Change: T133M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029345
Gene: ENSMUSG00000027776
AA Change: T133M

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
Pfam:IL12 27 236 2.5e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107816
AA Change: T112M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103446
Gene: ENSMUSG00000027776
AA Change: T112M

DomainStartEndE-ValueType
Pfam:IL12 1 215 6.8e-128 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195517
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. This cytokine is required for the T-cell-independent induction of interferon (IFN)-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null homozygotes have decreased NK cell responses, altered effector T cell differentiation, and increased susceptibility to parasitic infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T C 6: 92,805,046 (GRCm39) probably benign Het
Adamts17 G A 7: 66,797,322 (GRCm39) C986Y probably damaging Het
AI987944 A G 7: 41,024,763 (GRCm39) V75A probably benign Het
Arhgap10 T C 8: 78,244,378 (GRCm39) Y12C probably damaging Het
Atp11b G A 3: 35,832,162 (GRCm39) probably benign Het
Ccer1 T A 10: 97,530,520 (GRCm39) D394E possibly damaging Het
Cdh2 T C 18: 16,777,016 (GRCm39) N273S possibly damaging Het
Cfap65 G T 1: 74,957,663 (GRCm39) probably benign Het
Crybb3 A T 5: 113,228,444 (GRCm39) probably benign Het
D7Ertd443e G A 7: 133,950,663 (GRCm39) Q337* probably null Het
Dixdc1 C T 9: 50,588,293 (GRCm39) probably benign Het
Dut GCGGC GCGGCCGGC 2: 125,089,748 (GRCm39) probably null Het
Fbxo2 A G 4: 148,250,234 (GRCm39) probably null Het
Gm5174 T C 10: 86,491,972 (GRCm39) noncoding transcript Het
Gpam A G 19: 55,076,643 (GRCm39) probably benign Het
Itpr1 T A 6: 108,487,657 (GRCm39) V2361D possibly damaging Het
Jag1 G A 2: 136,938,152 (GRCm39) L283F probably damaging Het
Lamb2 A C 9: 108,360,892 (GRCm39) D538A probably benign Het
Map10 T A 8: 126,397,178 (GRCm39) C190* probably null Het
Pcnx2 C T 8: 126,498,843 (GRCm39) R1552H probably damaging Het
Phf1 T C 17: 27,156,244 (GRCm39) probably benign Het
Pitx2 A G 3: 129,012,418 (GRCm39) T276A probably damaging Het
Pparg A G 6: 115,467,107 (GRCm39) D490G probably damaging Het
Rnf10 A T 5: 115,398,163 (GRCm39) probably benign Het
Sbp T C 17: 24,161,704 (GRCm39) probably benign Het
Setbp1 A T 18: 78,900,841 (GRCm39) L942H probably damaging Het
Sf3b1 C G 1: 55,058,554 (GRCm39) E12Q possibly damaging Het
Sfmbt1 A T 14: 30,509,498 (GRCm39) N326Y possibly damaging Het
Slx4 G A 16: 3,808,774 (GRCm39) Q389* probably null Het
Srrm3 T A 5: 135,883,263 (GRCm39) V206E probably damaging Het
Sspo T A 6: 48,447,933 (GRCm39) D2270E possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,906,388 (GRCm39) probably null Het
Vmn1r14 T A 6: 57,211,184 (GRCm39) I210N probably damaging Het
Wasf3 T G 5: 146,372,182 (GRCm39) L13R probably damaging Het
Yes1 T C 5: 32,809,101 (GRCm39) probably null Het
Zfp292 T C 4: 34,807,569 (GRCm39) D1830G probably damaging Het
Zfp541 A G 7: 15,812,637 (GRCm39) N430S probably benign Het
Other mutations in Il12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Il12a APN 3 68,598,888 (GRCm39) missense possibly damaging 0.96
IGL01820:Il12a APN 3 68,599,495 (GRCm39) splice site probably benign
IGL01989:Il12a APN 3 68,598,909 (GRCm39) splice site probably benign
bakers_dozen UTSW 3 68,605,320 (GRCm39) frame shift probably null
R0388:Il12a UTSW 3 68,602,520 (GRCm39) splice site probably null
R0646:Il12a UTSW 3 68,605,223 (GRCm39) splice site probably benign
R1588:Il12a UTSW 3 68,602,896 (GRCm39) missense probably benign 0.04
R2240:Il12a UTSW 3 68,601,517 (GRCm39) nonsense probably null
R2909:Il12a UTSW 3 68,605,320 (GRCm39) frame shift probably null
R2925:Il12a UTSW 3 68,605,320 (GRCm39) frame shift probably null
R3696:Il12a UTSW 3 68,605,320 (GRCm39) frame shift probably null
R3697:Il12a UTSW 3 68,605,320 (GRCm39) frame shift probably null
R3698:Il12a UTSW 3 68,605,320 (GRCm39) frame shift probably null
R4332:Il12a UTSW 3 68,602,594 (GRCm39) intron probably benign
R5809:Il12a UTSW 3 68,602,595 (GRCm39) intron probably benign
R6279:Il12a UTSW 3 68,605,312 (GRCm39) missense probably damaging 0.96
R6305:Il12a UTSW 3 68,601,511 (GRCm39) missense possibly damaging 0.80
R6847:Il12a UTSW 3 68,602,899 (GRCm39) missense probably damaging 1.00
R7751:Il12a UTSW 3 68,605,235 (GRCm39) missense probably damaging 1.00
R8188:Il12a UTSW 3 68,598,872 (GRCm39) missense unknown
R8339:Il12a UTSW 3 68,599,438 (GRCm39) nonsense probably null
R9145:Il12a UTSW 3 68,598,875 (GRCm39) missense unknown
RF003:Il12a UTSW 3 68,602,562 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTAGAACGAGAGTTGCCTGGCTAC -3'
(R):5'- AAGGCTTACCTGCATCAGCTCATC -3'

Sequencing Primer
(F):5'- TGCCTGGCTACTAGAGAGACTTC -3'
(R):5'- ATGCCCTTGTCTAGAATGATCTG -3'
Posted On 2013-11-18