Incidental Mutation 'R1083:Arhgap10'
ID84925
Institutional Source Beutler Lab
Gene Symbol Arhgap10
Ensembl Gene ENSMUSG00000037148
Gene NameRho GTPase activating protein 10
SynonymsPSGAP-m, A930033B01Rik, PSGAP-s
MMRRC Submission 039169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R1083 (G1)
Quality Score209
Status Validated
Chromosome8
Chromosomal Location77250366-77517953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77517749 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 12 (Y12C)
Ref Sequence ENSEMBL: ENSMUSP00000147485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076316] [ENSMUST00000210519] [ENSMUST00000210922]
Predicted Effect probably damaging
Transcript: ENSMUST00000076316
AA Change: Y12C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075658
Gene: ENSMUSG00000037148
AA Change: Y12C

DomainStartEndE-ValueType
Pfam:BAR_3 6 249 3.3e-91 PFAM
PH 266 374 1.93e-6 SMART
RhoGAP 393 571 1.66e-63 SMART
low complexity region 633 649 N/A INTRINSIC
SH3 731 786 1.91e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184762
Predicted Effect probably damaging
Transcript: ENSMUST00000210519
AA Change: Y12C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000210922
AA Change: Y12C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit paraparesis, ataxic hindlimbs and splaying of hindlimbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T C 6: 92,828,065 probably benign Het
Adamts17 G A 7: 67,147,574 C986Y probably damaging Het
AI987944 A G 7: 41,375,339 V75A probably benign Het
Atp11b G A 3: 35,778,013 probably benign Het
Ccer1 T A 10: 97,694,658 D394E possibly damaging Het
Cdh2 T C 18: 16,643,959 N273S possibly damaging Het
Cfap65 G T 1: 74,918,504 probably benign Het
Crybb3 A T 5: 113,080,578 probably benign Het
D7Ertd443e G A 7: 134,348,934 Q337* probably null Het
Dixdc1 C T 9: 50,676,993 probably benign Het
Dut GCGGC GCGGCCGGC 2: 125,247,828 probably null Het
Fbxo2 A G 4: 148,165,777 probably null Het
Gm5174 T C 10: 86,656,108 noncoding transcript Het
Gpam A G 19: 55,088,211 probably benign Het
Il12a C T 3: 68,695,333 T112M probably damaging Het
Itpr1 T A 6: 108,510,696 V2361D possibly damaging Het
Jag1 G A 2: 137,096,232 L283F probably damaging Het
Lamb2 A C 9: 108,483,693 D538A probably benign Het
Map10 T A 8: 125,670,439 C190* probably null Het
Pcnx2 C T 8: 125,772,104 R1552H probably damaging Het
Phf1 T C 17: 26,937,270 probably benign Het
Pitx2 A G 3: 129,218,769 T276A probably damaging Het
Pparg A G 6: 115,490,146 D490G probably damaging Het
Rnf10 A T 5: 115,260,104 probably benign Het
Sbp T C 17: 23,942,730 probably benign Het
Setbp1 A T 18: 78,857,626 L942H probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sfmbt1 A T 14: 30,787,541 N326Y possibly damaging Het
Slx4 G A 16: 3,990,910 Q389* probably null Het
Srrm3 T A 5: 135,854,409 V206E probably damaging Het
Sspo T A 6: 48,470,999 D2270E possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Vmn1r14 T A 6: 57,234,199 I210N probably damaging Het
Wasf3 T G 5: 146,435,372 L13R probably damaging Het
Yes1 T C 5: 32,651,757 probably null Het
Zfp292 T C 4: 34,807,569 D1830G probably damaging Het
Zfp541 A G 7: 16,078,712 N430S probably benign Het
Other mutations in Arhgap10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Arhgap10 APN 8 77346291 missense possibly damaging 0.80
IGL01689:Arhgap10 APN 8 77411134 splice site probably benign
IGL01802:Arhgap10 APN 8 77420085 missense probably damaging 0.99
IGL01832:Arhgap10 APN 8 77259129 missense probably benign 0.00
IGL02291:Arhgap10 APN 8 77382715 splice site probably benign
IGL02834:Arhgap10 APN 8 77365100 missense probably damaging 1.00
IGL02928:Arhgap10 APN 8 77250910 unclassified probably benign
IGL03149:Arhgap10 APN 8 77409538 splice site probably benign
IGL03215:Arhgap10 APN 8 77277152 missense probably benign
IGL03331:Arhgap10 APN 8 77420082 missense probably damaging 0.99
R0276:Arhgap10 UTSW 8 77413581 missense probably benign 0.11
R0376:Arhgap10 UTSW 8 77450824 splice site probably benign
R0454:Arhgap10 UTSW 8 77250965 missense probably damaging 0.97
R0714:Arhgap10 UTSW 8 77351687 splice site probably benign
R1033:Arhgap10 UTSW 8 77257347 missense possibly damaging 0.80
R1036:Arhgap10 UTSW 8 77310769 missense probably damaging 0.98
R1596:Arhgap10 UTSW 8 77450697 missense possibly damaging 0.93
R1710:Arhgap10 UTSW 8 77358587 nonsense probably null
R1918:Arhgap10 UTSW 8 77259079 missense probably benign
R1937:Arhgap10 UTSW 8 77344653 missense probably damaging 1.00
R1959:Arhgap10 UTSW 8 77409626 missense possibly damaging 0.78
R2348:Arhgap10 UTSW 8 77450926 splice site probably benign
R3703:Arhgap10 UTSW 8 77259056 critical splice donor site probably null
R3979:Arhgap10 UTSW 8 77420725 missense probably benign 0.01
R4854:Arhgap10 UTSW 8 77420089 nonsense probably null
R4855:Arhgap10 UTSW 8 77432738 critical splice donor site probably null
R4928:Arhgap10 UTSW 8 77426328 critical splice donor site probably null
R5033:Arhgap10 UTSW 8 77382757 missense probably damaging 0.99
R5532:Arhgap10 UTSW 8 77420072 missense probably benign 0.19
R5644:Arhgap10 UTSW 8 77411055 missense probably benign 0.00
R5781:Arhgap10 UTSW 8 77450707 missense possibly damaging 0.56
R5824:Arhgap10 UTSW 8 77358552 nonsense probably null
R5861:Arhgap10 UTSW 8 77310764 missense probably damaging 1.00
R5872:Arhgap10 UTSW 8 77344638 critical splice donor site probably null
R6360:Arhgap10 UTSW 8 77259202 nonsense probably null
R6423:Arhgap10 UTSW 8 77517757 missense probably damaging 1.00
R6694:Arhgap10 UTSW 8 77411063 missense probably benign 0.00
R6900:Arhgap10 UTSW 8 77310862 missense probably damaging 1.00
R6936:Arhgap10 UTSW 8 77310747 nonsense probably null
R7001:Arhgap10 UTSW 8 77365088 missense possibly damaging 0.51
R7150:Arhgap10 UTSW 8 77250954 missense probably damaging 1.00
R7461:Arhgap10 UTSW 8 77388697 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTAAGGAATCGCCTATTCCTCCAGC -3'
(R):5'- AGGGCACAGACTACGTTCTCCATC -3'

Sequencing Primer
(F):5'- CTTAGGAGCACTGAGCCATC -3'
(R):5'- GCTGCCTCGGAAGGAAG -3'
Posted On2013-11-18