Incidental Mutation 'R1084:Mcf2l'
ID84954
Institutional Source Beutler Lab
Gene Symbol Mcf2l
Ensembl Gene ENSMUSG00000031442
Gene Namemcf.2 transforming sequence-like
SynonymsC130040G20Rik, Dbs
MMRRC Submission 039170-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1084 (G1)
Quality Score115
Status Validated
Chromosome8
Chromosomal Location12873806-13020905 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13002645 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 503 (V503A)
Ref Sequence ENSEMBL: ENSMUSP00000106503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095456] [ENSMUST00000098927] [ENSMUST00000110866] [ENSMUST00000110867] [ENSMUST00000110871] [ENSMUST00000110873] [ENSMUST00000110876] [ENSMUST00000110879] [ENSMUST00000145067] [ENSMUST00000173006] [ENSMUST00000173099]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095456
AA Change: V533A

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000093108
Gene: ENSMUSG00000031442
AA Change: V533A

DomainStartEndE-ValueType
SEC14 75 221 1.77e-24 SMART
SPEC 354 455 4.41e-15 SMART
coiled coil region 507 529 N/A INTRINSIC
low complexity region 578 594 N/A INTRINSIC
RhoGEF 636 811 2.83e-63 SMART
PH 831 948 8.13e-14 SMART
low complexity region 966 978 N/A INTRINSIC
SH3 1058 1115 3.33e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098927
AA Change: V507A

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096528
Gene: ENSMUSG00000031442
AA Change: V507A

DomainStartEndE-ValueType
SEC14 49 195 1.77e-24 SMART
SPEC 328 429 4.41e-15 SMART
coiled coil region 481 503 N/A INTRINSIC
low complexity region 552 568 N/A INTRINSIC
RhoGEF 610 785 2.83e-63 SMART
PH 805 922 8.13e-14 SMART
low complexity region 940 952 N/A INTRINSIC
low complexity region 1022 1033 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110866
AA Change: V481A

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106490
Gene: ENSMUSG00000031442
AA Change: V481A

DomainStartEndE-ValueType
SEC14 23 169 1.77e-24 SMART
SPEC 302 403 4.41e-15 SMART
coiled coil region 455 477 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
RhoGEF 584 759 2.83e-63 SMART
PH 779 896 8.13e-14 SMART
low complexity region 914 926 N/A INTRINSIC
SH3 1006 1063 3.33e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110867
AA Change: V481A

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106491
Gene: ENSMUSG00000031442
AA Change: V481A

DomainStartEndE-ValueType
SEC14 23 169 1.77e-24 SMART
SPEC 302 403 4.41e-15 SMART
coiled coil region 455 477 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
RhoGEF 584 759 2.83e-63 SMART
PH 779 896 8.13e-14 SMART
low complexity region 914 926 N/A INTRINSIC
SH3 1006 1063 3.33e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110871
AA Change: V501A

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106495
Gene: ENSMUSG00000031442
AA Change: V501A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SEC14 43 189 1.77e-24 SMART
SPEC 322 423 4.41e-15 SMART
coiled coil region 475 497 N/A INTRINSIC
low complexity region 546 562 N/A INTRINSIC
RhoGEF 604 779 2.83e-63 SMART
PH 799 916 8.13e-14 SMART
low complexity region 934 946 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110873
AA Change: V344A

PolyPhen 2 Score 0.318 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106497
Gene: ENSMUSG00000031442
AA Change: V344A

DomainStartEndE-ValueType
SPEC 165 266 4.41e-15 SMART
coiled coil region 318 340 N/A INTRINSIC
low complexity region 389 405 N/A INTRINSIC
RhoGEF 447 622 2.83e-63 SMART
PH 642 759 8.13e-14 SMART
low complexity region 777 789 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110876
AA Change: V503A

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106500
Gene: ENSMUSG00000031442
AA Change: V503A

DomainStartEndE-ValueType
SEC14 45 191 1.77e-24 SMART
SPEC 324 425 4.41e-15 SMART
coiled coil region 477 499 N/A INTRINSIC
low complexity region 548 564 N/A INTRINSIC
RhoGEF 606 781 2.83e-63 SMART
PH 801 918 8.13e-14 SMART
low complexity region 936 948 N/A INTRINSIC
SH3 1084 1141 3.33e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110879
AA Change: V503A

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106503
Gene: ENSMUSG00000031442
AA Change: V503A

DomainStartEndE-ValueType
SEC14 45 191 1.77e-24 SMART
SPEC 324 425 4.41e-15 SMART
coiled coil region 477 499 N/A INTRINSIC
low complexity region 548 564 N/A INTRINSIC
RhoGEF 606 781 2.83e-63 SMART
PH 801 918 8.13e-14 SMART
low complexity region 936 948 N/A INTRINSIC
SH3 1028 1085 3.33e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000126905
AA Change: V165A
SMART Domains Protein: ENSMUSP00000118540
Gene: ENSMUSG00000031442
AA Change: V165A

DomainStartEndE-ValueType
SPEC 5 88 8.25e-6 SMART
coiled coil region 139 161 N/A INTRINSIC
low complexity region 211 227 N/A INTRINSIC
RhoGEF 269 444 2.83e-63 SMART
PH 464 581 8.13e-14 SMART
low complexity region 599 611 N/A INTRINSIC
SH3 716 773 3.33e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145067
AA Change: V440A

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133577
Gene: ENSMUSG00000031442
AA Change: V440A

DomainStartEndE-ValueType
Pfam:CRAL_TRIO_2 16 132 2.4e-12 PFAM
SPEC 261 362 4.41e-15 SMART
coiled coil region 414 436 N/A INTRINSIC
low complexity region 485 501 N/A INTRINSIC
RhoGEF 543 718 2.83e-63 SMART
PH 738 855 8.13e-14 SMART
low complexity region 873 885 N/A INTRINSIC
SH3 1021 1078 3.33e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173006
AA Change: V412A

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134147
Gene: ENSMUSG00000031442
AA Change: V412A

DomainStartEndE-ValueType
Pfam:CRAL_TRIO_2 1 104 1.3e-12 PFAM
SPEC 233 334 4.41e-15 SMART
coiled coil region 386 408 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
RhoGEF 515 690 2.83e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173099
AA Change: V499A

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133776
Gene: ENSMUSG00000031442
AA Change: V499A

DomainStartEndE-ValueType
SEC14 41 187 1.77e-24 SMART
SPEC 320 421 4.41e-15 SMART
coiled coil region 473 495 N/A INTRINSIC
low complexity region 544 560 N/A INTRINSIC
RhoGEF 602 777 2.83e-63 SMART
PH 797 914 8.13e-14 SMART
low complexity region 932 944 N/A INTRINSIC
low complexity region 1014 1025 N/A INTRINSIC
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.3%
  • 20x: 93.7%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor that interacts specifically with the GTP-bound Rac1 and plays a role in the Rho/Rac signaling pathways. A variant in this gene was associated with osteoarthritis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,918,155 probably benign Het
Abcg4 C T 9: 44,277,469 V476M probably benign Het
Arhgap9 A G 10: 127,327,928 S478G probably damaging Het
Blvra A G 2: 127,080,653 T3A probably benign Het
Crygb C T 1: 65,080,495 D109N possibly damaging Het
Cyp3a59 A T 5: 146,096,674 T207S probably benign Het
Cyp4b1 A G 4: 115,640,312 V163A probably benign Het
Dmxl2 A T 9: 54,416,433 S1222R probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 G A 15: 28,343,452 V2333I probably benign Het
Eral1 C T 11: 78,074,498 V364M probably damaging Het
Fat4 T C 3: 38,979,825 V2542A possibly damaging Het
Glcci1 C T 6: 8,573,221 Q50* probably null Het
Heg1 A G 16: 33,706,997 D109G probably benign Het
Lama1 C A 17: 67,804,469 S2238R probably benign Het
Ltbp1 G A 17: 75,359,425 W1053* probably null Het
Ly6f T C 15: 75,268,773 L15P probably damaging Het
Mapk8 T A 14: 33,388,803 K290* probably null Het
Mbd1 A G 18: 74,269,532 Y35C probably damaging Het
Morc2a A G 11: 3,650,454 probably benign Het
Ms4a8a T A 19: 11,076,362 I127F probably damaging Het
Myo1d T C 11: 80,684,395 Y165C probably damaging Het
Ocel1 G T 8: 71,371,988 probably null Het
Plekhh2 C T 17: 84,571,126 T603M probably damaging Het
Rab6b C T 9: 103,162,635 T128M probably damaging Het
Scel G T 14: 103,564,843 probably null Het
Sec23a A T 12: 58,985,135 N436K probably damaging Het
Sec24a A G 11: 51,713,581 L736P probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Tex15 A G 8: 33,577,004 E2154G probably benign Het
Tnrc18 A G 5: 142,764,767 probably null Het
Tpr A G 1: 150,442,161 Q2140R probably benign Het
Zfp142 T C 1: 74,571,826 R834G probably benign Het
Zfp276 G A 8: 123,254,723 R3Q probably damaging Het
Zscan4d A T 7: 11,165,005 L115Q probably damaging Het
Other mutations in Mcf2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Mcf2l APN 8 13000857 missense probably damaging 0.98
IGL00426:Mcf2l APN 8 12984910 missense probably damaging 1.00
IGL01391:Mcf2l APN 8 13014010 splice site probably null
IGL01795:Mcf2l APN 8 13000749 unclassified probably null
IGL02314:Mcf2l APN 8 13001851 missense probably damaging 0.99
IGL02716:Mcf2l APN 8 12997277 missense probably benign 0.19
IGL02985:Mcf2l APN 8 12963239 missense probably damaging 1.00
IGL03073:Mcf2l APN 8 13000004 missense probably damaging 1.00
IGL03308:Mcf2l APN 8 13009512 missense probably damaging 1.00
IGL03371:Mcf2l APN 8 13001298 missense probably damaging 1.00
P0022:Mcf2l UTSW 8 13018897 nonsense probably null
R0062:Mcf2l UTSW 8 13006766 unclassified probably benign
R0067:Mcf2l UTSW 8 13013060 missense probably benign 0.01
R0110:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0450:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0469:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0510:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0543:Mcf2l UTSW 8 12996728 critical splice donor site probably null
R0591:Mcf2l UTSW 8 13018751 missense probably benign 0.11
R0801:Mcf2l UTSW 8 13014020 intron probably benign
R0962:Mcf2l UTSW 8 13001964 missense probably benign 0.14
R1794:Mcf2l UTSW 8 12915982 missense probably benign 0.33
R2111:Mcf2l UTSW 8 13001867 missense probably damaging 0.99
R2112:Mcf2l UTSW 8 13001867 missense probably damaging 0.99
R3785:Mcf2l UTSW 8 12880099 missense probably damaging 0.97
R4777:Mcf2l UTSW 8 13018051 splice site probably null
R4858:Mcf2l UTSW 8 13013972 missense probably damaging 1.00
R4980:Mcf2l UTSW 8 12984883 missense probably damaging 1.00
R5021:Mcf2l UTSW 8 13011808 missense probably damaging 1.00
R5067:Mcf2l UTSW 8 12915959 intron probably benign
R5158:Mcf2l UTSW 8 13009715 missense probably damaging 1.00
R5439:Mcf2l UTSW 8 12926646 missense possibly damaging 0.85
R5569:Mcf2l UTSW 8 13005481 missense probably damaging 1.00
R5655:Mcf2l UTSW 8 13010444 missense probably damaging 0.98
R5668:Mcf2l UTSW 8 13013812 nonsense probably null
R5753:Mcf2l UTSW 8 12999993 missense probably damaging 1.00
R5808:Mcf2l UTSW 8 12993937 start codon destroyed probably null 0.92
R5946:Mcf2l UTSW 8 13013922 missense probably damaging 1.00
R6168:Mcf2l UTSW 8 13001823 missense probably benign 0.05
R6174:Mcf2l UTSW 8 13013849 nonsense probably null
R6212:Mcf2l UTSW 8 13017431 missense probably damaging 1.00
R6270:Mcf2l UTSW 8 13018701 missense probably damaging 0.99
R6383:Mcf2l UTSW 8 12879912 start gained probably benign
R6850:Mcf2l UTSW 8 13009476 missense possibly damaging 0.82
R6908:Mcf2l UTSW 8 13018919 missense probably benign
R7101:Mcf2l UTSW 8 13013579 missense possibly damaging 0.80
R7163:Mcf2l UTSW 8 12915439 missense probably benign 0.00
R7203:Mcf2l UTSW 8 13010456 missense probably benign 0.09
R7414:Mcf2l UTSW 8 13019022 makesense probably null
R7553:Mcf2l UTSW 8 12997268 missense not run
R7556:Mcf2l UTSW 8 12973071 missense not run
X0052:Mcf2l UTSW 8 13018713 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGTAACTCCACTTCTGGGGCCATAG -3'
(R):5'- CTTGGCTGCCTGAGAGAAAGGATG -3'

Sequencing Primer
(F):5'- TGAAGATCACGCAGGTCTC -3'
(R):5'- CCTGAGAGAAAGGATGTACCTG -3'
Posted On2013-11-18