Incidental Mutation 'R1084:Sec24a'
ID84964
Institutional Source Beutler Lab
Gene Symbol Sec24a
Ensembl Gene ENSMUSG00000036391
Gene NameSec24 related gene family, member A (S. cerevisiae)
Synonyms9430090N21Rik
MMRRC Submission 039170-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R1084 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location51692264-51763634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51713581 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 736 (L736P)
Ref Sequence ENSEMBL: ENSMUSP00000104725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038210] [ENSMUST00000109097]
Predicted Effect probably damaging
Transcript: ENSMUST00000038210
AA Change: L735P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044370
Gene: ENSMUSG00000036391
AA Change: L735P

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 71 84 N/A INTRINSIC
low complexity region 196 235 N/A INTRINSIC
low complexity region 396 414 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 423 461 8e-19 PFAM
Pfam:Sec23_trunk 497 735 1.2e-87 PFAM
Pfam:Sec23_BS 740 824 1.1e-23 PFAM
Pfam:Sec23_helical 836 938 5.1e-27 PFAM
Pfam:Gelsolin 960 1035 7.2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109097
AA Change: L736P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104725
Gene: ENSMUSG00000036391
AA Change: L736P

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 71 84 N/A INTRINSIC
low complexity region 196 235 N/A INTRINSIC
low complexity region 396 414 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 425 462 2.4e-16 PFAM
Pfam:Sec23_trunk 498 736 7.8e-87 PFAM
Pfam:Sec23_BS 741 825 1.1e-22 PFAM
Pfam:Sec23_helical 838 938 6.9e-28 PFAM
Pfam:Gelsolin 961 1036 9.3e-14 PFAM
Meta Mutation Damage Score 0.52 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.3%
  • 20x: 93.7%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of proteins that are homologous to yeast Sec24. This protein is a component of coat protein II (COPII)-coated vesicles that mediate protein transport from the endoplasmic reticulum. COPII acts in the cytoplasm to promote the transport of secretory, plasma membrane, and vacuolar proteins from the endoplasmic reticulum to the golgi complex. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased circulating cholesterol level, decreased circulating LDL cholesterol level, and abnormal liver physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,918,155 probably benign Het
Abcg4 C T 9: 44,277,469 V476M probably benign Het
Arhgap9 A G 10: 127,327,928 S478G probably damaging Het
Blvra A G 2: 127,080,653 T3A probably benign Het
Crygb C T 1: 65,080,495 D109N possibly damaging Het
Cyp3a59 A T 5: 146,096,674 T207S probably benign Het
Cyp4b1 A G 4: 115,640,312 V163A probably benign Het
Dmxl2 A T 9: 54,416,433 S1222R probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 G A 15: 28,343,452 V2333I probably benign Het
Eral1 C T 11: 78,074,498 V364M probably damaging Het
Fat4 T C 3: 38,979,825 V2542A possibly damaging Het
Glcci1 C T 6: 8,573,221 Q50* probably null Het
Heg1 A G 16: 33,706,997 D109G probably benign Het
Lama1 C A 17: 67,804,469 S2238R probably benign Het
Ltbp1 G A 17: 75,359,425 W1053* probably null Het
Ly6f T C 15: 75,268,773 L15P probably damaging Het
Mapk8 T A 14: 33,388,803 K290* probably null Het
Mbd1 A G 18: 74,269,532 Y35C probably damaging Het
Mcf2l T C 8: 13,002,645 V503A possibly damaging Het
Morc2a A G 11: 3,650,454 probably benign Het
Ms4a8a T A 19: 11,076,362 I127F probably damaging Het
Myo1d T C 11: 80,684,395 Y165C probably damaging Het
Ocel1 G T 8: 71,371,988 probably null Het
Plekhh2 C T 17: 84,571,126 T603M probably damaging Het
Rab6b C T 9: 103,162,635 T128M probably damaging Het
Scel G T 14: 103,564,843 probably null Het
Sec23a A T 12: 58,985,135 N436K probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Tex15 A G 8: 33,577,004 E2154G probably benign Het
Tnrc18 A G 5: 142,764,767 probably null Het
Tpr A G 1: 150,442,161 Q2140R probably benign Het
Zfp142 T C 1: 74,571,826 R834G probably benign Het
Zfp276 G A 8: 123,254,723 R3Q probably damaging Het
Zscan4d A T 7: 11,165,005 L115Q probably damaging Het
Other mutations in Sec24a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Sec24a APN 11 51736504 nonsense probably null
IGL00973:Sec24a APN 11 51729577 critical splice acceptor site probably null
IGL01364:Sec24a APN 11 51713529 critical splice donor site probably null
IGL01476:Sec24a APN 11 51708956 missense possibly damaging 0.88
IGL01725:Sec24a APN 11 51723578 splice site probably null
IGL02069:Sec24a APN 11 51733934 splice site probably benign
IGL02230:Sec24a APN 11 51709034 missense possibly damaging 0.88
IGL02617:Sec24a APN 11 51712187 critical splice donor site probably null
IGL02655:Sec24a APN 11 51734655 missense probably benign 0.43
IGL02756:Sec24a APN 11 51696733 missense probably benign 0.02
IGL03396:Sec24a APN 11 51708967 missense probably benign 0.17
R0153:Sec24a UTSW 11 51700826 missense probably benign 0.08
R0506:Sec24a UTSW 11 51743795 missense probably benign 0.03
R0625:Sec24a UTSW 11 51729454 missense probably damaging 0.98
R1166:Sec24a UTSW 11 51733467 missense possibly damaging 0.72
R1376:Sec24a UTSW 11 51700913 splice site probably benign
R1487:Sec24a UTSW 11 51731886 missense possibly damaging 0.92
R1541:Sec24a UTSW 11 51743796 missense probably benign 0.41
R1582:Sec24a UTSW 11 51708967 missense probably benign 0.17
R1643:Sec24a UTSW 11 51704385 missense probably benign 0.03
R1672:Sec24a UTSW 11 51743948 nonsense probably null
R1681:Sec24a UTSW 11 51695189 missense probably damaging 0.98
R1756:Sec24a UTSW 11 51733763 splice site probably benign
R1992:Sec24a UTSW 11 51736363 missense probably benign 0.00
R2159:Sec24a UTSW 11 51712350 missense probably damaging 1.00
R2177:Sec24a UTSW 11 51704401 missense probably benign 0.00
R2188:Sec24a UTSW 11 51723584 missense probably damaging 0.99
R2271:Sec24a UTSW 11 51716450 missense possibly damaging 0.91
R3414:Sec24a UTSW 11 51729458 missense probably damaging 1.00
R4349:Sec24a UTSW 11 51715149 missense probably benign 0.03
R4396:Sec24a UTSW 11 51715164 missense possibly damaging 0.86
R4629:Sec24a UTSW 11 51721813 critical splice donor site probably null
R5061:Sec24a UTSW 11 51713532 splice site probably null
R5577:Sec24a UTSW 11 51734621 missense probably benign 0.06
R5717:Sec24a UTSW 11 51707210 missense probably benign
R5915:Sec24a UTSW 11 51756137 missense probably benign 0.11
R6175:Sec24a UTSW 11 51731891 missense probably damaging 1.00
R6341:Sec24a UTSW 11 51717776 missense probably damaging 0.99
R6461:Sec24a UTSW 11 51713546 missense possibly damaging 0.76
R6610:Sec24a UTSW 11 51696656 missense probably benign
R6632:Sec24a UTSW 11 51713649 nonsense probably null
R6907:Sec24a UTSW 11 51712276 missense probably damaging 1.00
R6969:Sec24a UTSW 11 51700816 missense probably benign 0.35
R7132:Sec24a UTSW 11 51715136 nonsense probably null
X0025:Sec24a UTSW 11 51729547 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCACACCCAGGCATTTTCTTT -3'
(R):5'- GTAGTCCCACGCACGAGTGAATAAA -3'

Sequencing Primer
(F):5'- caccagaagagggcatcag -3'
(R):5'- TAAAGGGGTGTCTAAAAGGAGTGTG -3'
Posted On2013-11-18